Skip to main content Skip to navigation
Oligo Mouse Anti-Human B7-H4

BD™ AbSeq Oligo Mouse Anti-Human B7-H4

Clone MIH43

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
VTCN1; VCTN1; B7 family member, H4; B7H4; B7h.5; B7S1; B7X
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TAGAGTGACCGGACCTTGTGTGACGTGTAATGTATC
AHS0108
Recombinant Human B7-H4 protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940100 Rev. 3
Antibody Details
Down Arrow Up Arrow
MIH43

The MIH43 monoclonal antibody specifically binds to human B7-H4 (B7 family member, H4) that is encoded by the VTCN1 (V-set domain containing T cell activation inhibitor 1) gene. B7-H4 is a type I membrane glycoprotein with a calculated molecular weight of 30.89 kDa. It is also known as VCTN1, B7h.5, B7S1 (B7 superfamily member 1) or B7X. B7-H4 is a newly discovered member of the B7 family of costimulatory proteins. B7-H4 is not constitutively expressed on peripheral tissues. Its expression can be induced on macrophages, dendritic cells, B cells and T cells. By binding to its putative receptor, the function of B7-H4 was initially reported to be a negative regulator of T cell activation, proliferation and differentiation related to cytokine production and cytotoxic effector cell functions. B7-H4 is reportedly overexpressed in a variety tumors. B7-H4 expression by tumor macrophages appears to play a role in suppression antigen-specific T cell mediated immunity. Recent studies indicate that B7-H4 can also be a positive regulator of T cell responses. B7-H4 can be involved innate immunity as well, eg, by inhibiting neutrophil expansion.

940100 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940100 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940100" on CiteAb

Development References (4)

  1. Choi IH, Zhu G, Sica GL, et al. Genomic organization and expression analysis of B7-H4, an immune inhibitory molecule of the B7 family. J Immunol. 2003; 171(9):4650-4654. (Biology). View Reference
  2. Kryczek I, Zou L, Rodriguez P, et al. B7-H4 expression identifies a novel suppressive macrophage population in human ovarian carcinoma. J Exp Med. 2006; 203(4):871-881. (Biology). View Reference
  3. Quandt D, Fiedler E, Boettcher D, Marsch WCh, Seliger B. B7-h4 expression in human melanoma: its association with patients' survival and antitumor immune response.. Clin Cancer Res. 2011; 17(10):3100-11. (Clone-specific: Flow cytometry). View Reference
  4. Sica GL, Choi IH, Zhu G, et al. B7-H4, a molecule of the B7 family, negatively regulates T cell immunity. Immunity. 2003; 18(6):849-861. (Biology). View Reference
940100 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.