Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD3

BD™ AbSeq Oligo Hamster Anti-Mouse CD3

Clone 145-2C11

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD3; CD3 epsilon; Cd3e; CD3ε; T3e
12501
2 µl
Armenian Hamster IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GAGATAGGCTAGTTGGATAATTGCGCGGTGAGAGTC
AMM2001
H-2Kb specific cytotoxic T lymphocyte clone BM10-37
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940107 Rev. 2
Antibody Details
Down Arrow Up Arrow
145-2C11

The 145-2C11 monoclonal antibody specifically binds to the 25-kDa ε chain of the T-cell receptor-associated CD3 complex that is expressed on thymocytes, mature T lymphocytes, and NK-T cells. The cytoplasmic domain of CD3e participates in the signal transduction events that activate several cellular biochemical pathways as a result of antigen recognition. Soluble 145-2C11 antibody can activate either unprimed (naive) or primed (memory/preactivated) T cells in vivo or in vitro, in the presence of Fc receptor-bearing accessory cells.  In contrast, plate-bound 145-2C11 can activate T cells in the absence of accessory cells. Soluble 145-2C11 antibody has been reported to induce re-directed lysis of Fc receptor-bearing target cells by CTL clones and can also block lysis of specific target cells by antigen-specific CTL's. Under some conditions, T-cell activation by 145-2C11 antibody has been reported to result in apoptotic cell death. The 145-2C11 antibody does not cross-react with rat leukocytes. Preincubation of thymus cell suspensions at 37°C for 2-4 hours prior to staining reportedly enhances the ability of anti-CD3ε and anti-αβ TCR mAbs to detect the T-cell receptor on immature thymocytes.

940107 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940107 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (14)

  1. Castro JE, Listman JA, Jacobson BA, et al. Fas modulation of apoptosis during negative selection of thymocytes. Immunity. 1996; 5(6):617-627. (Clone-specific: Activation, Apoptosis). View Reference
  2. Duke RC, Cohen JJ, Boehme SA, et al. Morphological, biochemical, and flow cytometric assays of apoptosis. In: Coligan J, Kruisbeek AM, Margulies D, Shevach EM, Strober W, ed. Current Protocols in Immunology. New York: John Wiley and Sons; 1995:3.17.1-3.17.33.
  3. Ernst DN, Weigle WO, McQuitty DN, Rothermel AL, Hobbs MV. Stimulation of murine T cell subsets with anti-CD3 antibody. Age-related defects in the expression of early activation molecules. J Immunol. 1989; 142(5):1413-1421. (Clone-specific: Activation, Functional assay, Stimulation). View Reference
  4. Isakov N, Wange RL, Burgess WH, Watts JD, Aebersold R, Samelson LE. ZAP-70 binding specificity to T cell receptor tyrosine-based activation motifs: the tandem SH2 domains of ZAP-70 bind distinct tyrosine-based activation motifs with varying affinity. J Exp Med. 1995; 181(1):375-380. (Biology). View Reference
  5. Kruisbeek AM, Shevach EM. Proliferative assays for T cell function. Curr Protoc Immunol. 2004; 3:3.12.1-3.12.14. (Methodology: Activation, Stimulation). View Reference
  6. Kubo RT, Born W, Kappler JW, Marrack P, Pigeon M. Characterization of a monoclonal antibody which detects all murine alpha beta T cell receptors. J Immunol. 1989; 142(8):2736-2742. (Clone-specific: Activation, Flow cytometry, Immunoprecipitation, Stimulation). View Reference
  7. Leo O, Foo M, Sachs DH, Samelson LE, Bluestone JA. Identification of a monoclonal antibody specific for a murine T3 polypeptide. Proc Natl Acad Sci U S A. 1987; 84(5):1374-1378. (Immunogen: Activation, Blocking, Cytotoxicity, Flow cytometry, Immunoprecipitation, Inhibition, Stimulation). View Reference
  8. Nakano H, Yamazaki T, Miyatake S, Nozaki N, Kikuchi A, Saito T. Specific interaction of topoisomerase II beta and the CD3 epsilon chain of the T cell receptor complex. J Biol Chem. 1996; 271(11):6483-6489. (Clone-specific: Functional assay, Stimulation). View Reference
  9. Portoles P, Rojo J, Golby A, et al . Monoclonal antibodies to murine CD3 epsilon define distinct epitopes, one of which may interact with CD4 during T cell activation. J Immunol. 1989; 142(12):4169-4175. (Clone-specific: Blocking, Cytotoxicity, Immunoprecipitation, Radioimmunoassay). View Reference
  10. Radvanyi LG, Mills GB, Miller RG. Religation of the T cell receptor after primary activation of mature T cells inhibits proliferation and induces apoptotic cell death. J Immunol. 1993; 150(12):5704-5715. (Clone-specific: Activation, Apoptosis). View Reference
  11. Salvadori S, Gansbacher B, Pizzimenti AM, Zier KS. Abnormal signal transduction by T cells of mice with parental tumors is not seen in mice bearing IL-2-secreting tumors. J Immunol. 1994; 153(11):5176-5182. (Clone-specific: Activation, Calcium Flux, Flow cytometry, Western blot). View Reference
  12. Shinkai Y, Alt FW. CD3 epsilon-mediated signals rescue the development of CD4+CD8+ thymocytes in RAG-2-/- mice in the absence of TCR beta chain expression. Int Immunol. 1994; 6(7):995-1001. (Biology). View Reference
  13. Ucker DS, Meyers J, Obermiller PS. Activation-driven T cell death. II. Quantitative differences alone distinguish stimuli triggering nontransformed T cell proliferation or death. J Immunol. 1992; 149(5):1583-1592. (Clone-specific: Activation, Apoptosis). View Reference
  14. Wang R, Murphy KM, Loh DY, Weaver C, Russell JH. Differential activation of antigen-stimulated suicide and cytokine production pathways in CD4+ T cells is regulated by the antigen-presenting cell. J Immunol. 1993; 150(9):3832-3842. (Clone-specific: Activation, Apoptosis). View Reference
View All (14) View Less
940107 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.