Skip to main content Skip to navigation
Oligo Rat Anti-Mouse VISTA

BD™ AbSeq Oligo Rat Anti-Mouse VISTA

Clone MIH64

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Vista; PD-1H; Dies1
387836
2 µl
Rat IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGAGCTCGGTAAGGTGAACTGTCGTATATATGTGTC
AMM2115
Mouse VISTA Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940331 Rev. 2
Antibody Details
Down Arrow Up Arrow
MIH64

The MIH64 monoclonal antibody specifically binds to V-domain Ig suppressor of T cell activation (VISTA) which is also known as, Differentiation of ESCs 1 (Dies1). VISTA is a type I transmembrane glycoprotein that belongs to the Ig superfamily. VISTA has homology to the B7 family ligand, PD-L1 (CD274), and is likewise known as PD-1H. VISTA is expressed on naïve and activated T cells, natural killer (NK) cells, macrophages, dendritic cells, and neutrophils. VISTA functions as an inhibitory ligand. It can serve as a negative immune-checkpoint protein that suppresses T cell cytokine production and proliferation. It is also involved in regulating stem cell differentiation.

940331 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940331 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (5)

  1. Flies DB, Han X, Higuchi T, et al. Coinhibitory receptor PD-1H preferentially suppresses CD4⁺ T cell-mediated immunity.. J Clin Invest. 2014; 124(5):1966-75. (Biology). View Reference
  2. Flies DB, Wang S, Xu H, Chen L. Cutting edge: A monoclonal antibody specific for the programmed death-1 homolog prevents graft-versus-host disease in mouse models.. J Immunol. 2011; 187(4):1537-41. (Biology). View Reference
  3. Kondo Y, Ohno T, Azuma M. Effects of anti-VISTA mAb and its combination therapy in antitumor immunity. Abstract.. J Immunol. 2015; 194(1 Supplement):69.32. (Clone-specific). View Reference
  4. Ohno T, Kondo Y, Azuma M. T cell-dependent and-independent regulatory roles of a new inhibitory molecule VISTA. J Immunol. 2015; 194(1 Supplement):113.16. (Clone-specific).
  5. Wang L, Rubinstein R, Lines JL, et al. VISTA, a novel mouse Ig superfamily ligand that negatively regulates T cell responses.. J Exp Med. 2011; 208(3):577-92. (Biology). View Reference
940331 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.