Skip to main content Skip to navigation
Oligo Rat Anti-Mouse TIM-4

BD™ AbSeq Oligo Rat Anti-Mouse TIM-4

Clone RMT4-54 (RUO)

940351
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
TIMD-4, SMUCKLER, Tim4, Timd4
276891
2 µl
Rat SD, also known as Sprague-Dawley (outbred) IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CATGTGTCGAATTAAAGTGTTGCGTGGGCCGTGTTG
AMM2153
Mouse Tim-4 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940351 Rev. 2
Antibody Details
Down Arrow
RMT4-54

The RMT4-54 monoclonal antibody specifically binds to TIM-4. TIM-4 is encoded by Timd4 (T cell immunoglobulin and mucin domain containing 4). TIM-4 is also known as Spleen, mucin-containing, knockout of lymphotoxin protein (SMUCKLER). TIM-4 is a single-pass type I membrane transmembrane glycoprotein belonging to the TIM family of the immunoglobulin superfamily. TIM-4 is expressed by macrophages and at low levels by dendritic cells. TIM-4 is a phosphatidylserine receptor that enhances the phagocytosis of apoptotic cells.  It can serve as a receptor for TIM-1, also known as the Hepatitis A virus cellular receptor 1 (Havcr1).

940351 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940351 Rev.2
Citations & References
Down Arrow

Development References (3)

  1. Curtiss ML, Gorman JV, Businga TR, et al. Tim-1 regulates Th2 responses in an airway hypersensitivity model. Eur J Immunol. 2012; 42(3):651-661. (Clone-specific: Flow cytometry). View Reference
  2. Freeman GJ, Casasnovas JM, Umetsu DT, DeKruyff RH. TIM genes: a family of cell surface phosphatidylserine receptors that regulate innate and adaptive immunity.. Immunol Rev. 2010; 235(1):172-89. (Biology). View Reference
  3. Nakayama M, Akiba H, Takeda K, et al. Tim-3 mediates phagocytosis of apoptotic cells and cross-presentation. Blood. 2009; 113(16):3821-3830. (Immunogen: Blocking, Flow cytometry, Functional assay, Inhibition, In vivo exacerbation). View Reference
940351 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.