Skip to main content Skip to navigation
Oligo Rat Anti-Mouse Pre-B Cell Receptor

BD™ AbSeq Oligo Rat Anti-Mouse Pre-B Cell Receptor

Clone SL156 (RUO)

940323
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
Pre-BCR
16019, 16136, 22362
2 µl
Rat LEW, also known as Lewis IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CCGTAGTGCGATTTGGCGTGTATATTGGTTAGTGGC
AMM2107
Purified soluble complex of recombinant µ IgH, λ5, and VpreB
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940323 Rev. 2
Antibody Details
Down Arrow
SL156

The pre-B cell receptor (pre-BCR) expressed during the early stages of B lymphocyte development is a heterodimer of immunoglobulin heavy chain (IgH) with surrogate light chain, which is an Ig-light-chain-like molecule composed of the non-covalently linked Lambda 5 (λ5) and VpreB proteins. The pre-BCR is believed to control IgH repertoire selection and proliferation of differentiating B lymphocytes. The SL156 antibody reacts with a conformational epitope of the pre-BCR in transfected X63-Ag8.653 cells but not with surrogate light chain, λ5, or VpreB in the absence of IgH. It detects pre-BCR on pre-B cell lines, but not on pro-B cell lines or IgM-positive splenocytes. It also detects pre-BCR on the surface of pre-B cells, but not on Ig light chain (IgL)-positive B lymphocytes, from the bone marrow of normal mice. It has been noted that the cell-surface expression of pre-BCR is upregulated after a one-hour incubation of bone-marrow leukocytes in tissue culture medium at 37°C. After immunization, cell-surface pre-BCR is detected on a subset of splenic IgL+ germinal-center B lymphocytes.

940323 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940323 Rev.2
Citations & References
Down Arrow

Development References (6)

  1. Karasuyama H, Rolink A, Melchers F. A complex of glycoproteins is associated with VpreB/lambda 5 surrogate light chain on the surface of mu heavy chain-negative early precursor B cell lines. J Exp Med. 1993; 178(2):469-478. (Immunogen). View Reference
  2. Martensson IL, Ceredig R. Review article: role of the surrogate light chain and the pre-B-cell receptor in mouse B-cell development. Immunology. 2000; 101(4):435-441. (Biology). View Reference
  3. Meffre E, Papavasiliou F, Cohen P, et al. Antigen receptor engagement turns off the V(D)J recombination machinery in human tonsil B cells. J Exp Med. 1998; 188(4):765-772. (Biology). View Reference
  4. Melchers F, ten Boekel E, Seidl T, et al. Repertoire selection by pre-B-cell receptors and B-cell receptors, and genetic control of B-cell development from immature to mature B cells. Immunol Rev. 2000; 175:33-46. (Biology). View Reference
  5. Shimizu T, Mundt C, Licence S, Melchers F, Martensson IL. VpreB1/VpreB2/lambda 5 triple-deficient mice show impaired B cell development but functional allelic exclusion of the IgH locus. J Immunol. 2002; 168(12):6286-6293. (Biology). View Reference
  6. Winkler TH, Rolink A, Melchers F, Karasuyama H. Precursor B cells of mouse bone marrow express two different complexes with the surrogate light chain on the surface. Eur J Immunol. 1995; 25(2):446-450. (Immunogen). View Reference
View All (6) View Less
940323 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.