Skip to main content Skip to navigation
Oligo Rat Anti-Mouse Ly-6G and Ly-6C

BD™ AbSeq Oligo Rat Anti-Mouse Ly-6G and Ly-6C

Clone RB6-8C5

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Ly6c, Lymphocyte antigen 6C2; Lymphocyte antigen 6G, Ly6g, Gr-1
17067, 546644
2 µl
Rat IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CATTGCGAGGAGTAAGGCGATATCTAGTTGTGCTGG
AMM2015
Not Reported
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940119 Rev. 2
Antibody Details
Down Arrow Up Arrow
RB6-8C5

The RB6-8C5 monoclonal antibody recognizes a common epitope on Ly-6G and Ly-6C, previously known as the myeloid differentiation antigen Gr-1. In the bone marrow, the level of antigen expression is directly correlated with granulocyte differentiation and maturation. The antigen is also expressed on the monocyte lineage in the bone marrow, but not on erythroid cells. In the periphery, RB6-8C5 antibody recognizes granulocytes (neutrophils and eosinophils) and monocytes. The RB6-8C5 antibody is a component of the "lineage cocktail" used in studies of hematopoietic cell lineages. The 1A8 antibody (Cat. No. 551461) specifically recognizes Ly-6G, but not Ly-6C.

Based on comparison of the staining patterns given by 1A8 versus RB6-8C5 antibodies on total blood leucocytes, it is evident that the 1A8 antibody stains the RB6-8C5-bright population, corresponding to Ly-6G-expressing granulocytes; whereas, the RB6-8C5-dim population is 1A8-negative and corresponds to Ly-6C-expressing lymphocytes and monocytes. Please refer to the Technical Data Sheets for Cat. No. 551459 and 553128 for more detailed information.

940119 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940119 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (11)

  1. Brummer E, Sugar AM, Stevens DA. Immunological activation of polymorphonuclear neutrophils for fungal killing: studies with murine cells and blastomyces dermatitidis in vitro. J Leukoc Biol. 1984; 36(4):505-520. (Clone-specific: Cytotoxicity). View Reference
  2. Conlan JW, North RJ. Neutrophils are essential for early anti-Listeria defense in the liver, but not in the spleen or peritoneal cavity, as revealed by a granulocyte-depleting monoclonal antibody. J Exp Med. 1994; 179(1):259-268. (Clone-specific: Depletion, Western blot). View Reference
  3. Czuprynski CJ, Brown JF, Maroushek N, Wagner RD, Steinberg H. Administration of anti-granulocyte mAb RB6-8C5 impairs the resistance of mice to Listeria monocytogenes infection. J Immunol. 1994; 152(4):1836-1846. (Clone-specific: Depletion, Western blot). View Reference
  4. Fleming TJ, Fleming ML, Malek TR. Selective expression of Ly-6G on myeloid lineage cells in mouse bone marrow. RB6-8C5 mAb to granulocyte-differentiation antigen (Gr-1) detects members of the Ly-6 family. J Immunol. 1993; 151(5):2399-2408. (Clone-specific: Immunoprecipitation). View Reference
  5. Gumley TP, McKenzie IF, Sandrin MS. Tissue expression, structure and function of the murine Ly-6 family of molecules. Immunol Cell Biol. 1995; 73(4):277-296. (Biology). View Reference
  6. Hestdal K, Ruscetti FW, Ihle JN, et al. Characterization and regulation of RB6-8C5 antigen expression on murine bone marrow cells. J Immunol. 1991; 147(1):22-28. (Biology). View Reference
  7. Lagasse E, Weissman IL. Flow cytometric identification of murine neutrophils and monocytes. J Immunol Methods. 1996; 197(1-2):139-150. (Biology). View Reference
  8. Lewinsohn DM, Bargatze RF, Butcher EC. Leukocyte-endothelial cell recognition: evidence of a common molecular mechanism shared by neutrophils, lymphocytes, and other leukocytes. J Immunol. 1987; 138(12):4313-4321. (Biology). View Reference
  9. Stoppacciaro A, Melani C, Parenza M, et al. Regression of an established tumor genetically modified to release granulocyte colony-stimulating factor requires granulocyte-T cell cooperation and T cell-produced interferon gamma. J Exp Med. 1993; 178(1):151-161. (Clone-specific: Depletion, Immunohistochemistry). View Reference
  10. Tepper RI, Coffman RL, Leder P. An eosinophil-dependent mechanism for the antitumor effect of interleukin-4. Science. 1992; 257(5069):548-551. (Biology). View Reference
  11. Tumpey TM, Chen SH, Oakes JE, Lausch RN. Neutrophil-mediated suppression of virus replication after herpes simplex virus type 1 infection of the murine cornea. J Virol. 1996; 70(2):898-904. (Clone-specific: Depletion). View Reference
View All (11) View Less
940119 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.