Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD93 (Early B Lineage)

BD™ AbSeq Oligo Rat Anti-Mouse CD93 (Early B Lineage)

Clone AA4.1 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Aa4; Cd93; C1qRp; C1qr1; Ly-68; Ly68; C1q/MBL/SPA receptor
2 µl
Rat SD, also known as Sprague-Dawley (outbred) IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTAACGTGACGAAGAGTAATGATATGAGGGCCTGGT
AMM2099
Pre-B lymphoma 70Z/3, derived from (C57BL/6 x DBA/2)F1 mouse
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940203 Rev. 2
Antibody Details
Down Arrow Up Arrow
AA4.1

The AA4.1 monoclonal antibody specifically recognizes the Early B Lineage antigen which is also known as CD93, AA4 antigen, Ly-68, and Complement component C1q receptor (C1qRp). This 130-140-kDa type I transmembrane glycoprotein is expressed on immature B lymphocytes in the adult bone marrow and on  hematopoietic progenitors and stem cells in adult bone marrow, fetal liver, and embryonic yolk sac. Although CD93+ cells are most plentiful in adult mouse bone marrow, a smaller number of CD93+ cells which express lower CD93 levels can be detected in the adult spleen using bright fluorescent conjugates of the AA4.1 antibody or an amplified indirect immunofluorescent staining procedure. It has been observed that the staining pattern of the 493 monoclonal antibody is similar to that of the AA4.1 antibody, in that both antibodies precipitate molecules of the same molecular weight. Staining with the AA4.1 antibody is not blocked by the 493 antibody. These results suggest that the antibodies recognize separate epitopes on the same Early B Lineage antigen.

940203 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940203 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940203" on CiteAb

Development References (9)

  1. Allman D, Li J, Hardy RR. Commitment to the B lymphoid lineage occurs before DH-JH recombination. J Exp Med. 1999; 189(4):735-740. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
  2. Allman D, Lindsley RC, DeMuth W, Rudd K, Shinton SA, Hardy RR. Resolution of three nonproliferative immature splenic B cell subsets reveals multiple selection points during peripheral B cell maturation. J Immunol. 2001; 167(12):6834-6840. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
  3. Auerbach R, Huang H, Lu L. Hematopoietic stem cells in the mouse embryonic yolk sac. Stem Cells. 1996; 14(3):269-280. (Clone-specific). View Reference
  4. Jordan CT, McKearn JP, Lemischka IR. Cellular and developmental properties of fetal hematopoietic stem cells. Cell. 1990; 61(6):953-963. (Clone-specific: Flow cytometry). View Reference
  5. Lacaud G, Carlsson L, Keller G. Identification of a fetal hematopoietic precursor with B cell, T cell, and macrophage potential. Immunity. 1998; 9(6):827-838. (Clone-specific). View Reference
  6. Li YS, Wasserman R, Hayakawa K, Hardy RR. Identification of the earliest B lineage stage in mouse bone marrow. Immunity. 1996; 5(6):527-535. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
  7. McKearn JP, Baum C, Davie JM. Cell surface antigens expressed by subsets of pre-B cells and B cells. J Immunol. 1984; 132(1):332-339. (Immunogen: Cell separation, Depletion, Flow cytometry). View Reference
  8. Paige CJ, Gisler RH, McKearn JP, Iscove NN. Differentiation of murine B cell precursors in agar culture. Frequency, surface marker analysis and requirements for growth of clonable pre-B cells. Eur J Immunol. 1984; 14(11):979-987. (Clone-specific). View Reference
  9. Szilvassy SJ, Cory S. Phenotypic and functional characterization of competitive long-term repopulating hematopoietic stem cells enriched from 5-fluorouracil-treated murine marrow. Blood. 1993; 81(9):2310-2320. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
View All (9) View Less
940203 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.