Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD44

BD™ AbSeq Oligo Rat Anti-Mouse CD44

Clone IM7

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Pgp-1; Ly-24; H-CAM; HERMES; ECMR-III; Hyaluronate Receptor
12505
2 µl
Rat IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CATGGGTTGTCTCGTTGTAAGTAGTATAGTTGCTGC
AMM2010
Dexamethasone-induced, SJL mouse spontaneous myeloid leukemia M1 cells myeloid leukemia M1
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940114 Rev. 2
Antibody Details
Down Arrow Up Arrow
IM7

The IM7 antibody specifically recognizes an epitope on both alloantigens and all isoforms of the CD44 glycoprotein (Pgp-1, Ly-24). The standard form of CD44, lacking variable exons and referred to as CD44H or CD44s, is widely expressed on hematopoietic and non-hematopoietic cells. CD44 isoforms encoded by variable exons are expressed on epithelial cells, but only at low levels on most leukocytes. Mice with the Ly-24.1 alloantigen (e.g., BALB/c, CBA/J, DBA/1, DBA/2) have relatively large subsets of CD44H+ T lymphocytes, while Ly-24.2 strains (e.g., A, AKR, CBA/N, C3H/He, C57BL, C57BR, C57L, C58, NZB, SJL, SWR, 129) have fewer CD44H+ T cells. CD44 is a cell adhesion receptor, and its principal ligand, hyaluronate, is a common component of extracellular matrices. Differential glycosylation of CD44 influences its binding to hyaluronate.  Additional ligands include the cell surface form of CD74 and the cytokine osteopontin (Eta-1). Bone marrow- and thymus-derived progenitor cells capable of repopulating the thymus express CD44. In the periphery, the level of CD44 expression increases upon activation of B lymphocytes, CD4+ T cells, and CD8+ T cells; memory cells can be recognized by their CD44[hi] phenotype. The IM7 mAb inhibits established collagen-induced arthritis in DBA/1 mice. Moreover, it prevents CNS inflammation and clinical symptoms of experimental autoimmune encephalomyelitis. In contrast, the same antibody exacerbates experimental autoimmune thyroiditis in CBA/J mice. The IM7 mAb recognizes a different epitope from that recognized by mAb KM114, and the antibody pair can be used in ELISA to detect soluble CD44. It has been observed that IM7 antibody crossreacts with human, dog, cat, horse, cow, and pig leukocytes. Anti-human CD44, clone G44-26, and IM7 antibody compete for binding to human peripheral blood lymphocytes.

940114 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940114 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (18)

  1. Brocke S, Piercy C, Steinman L, Weissman IL, Veromaa T. Antibodies to CD44 and integrin alpha4, but not L-selectin, prevent central nervous system inflammation and experimental encephalomyelitis by blocking secondary leukocyte recruitment. Proc Natl Acad Sci U S A. 1999; 96(12):6896-6901. (Clone-specific: Blocking). View Reference
  2. Budd RC, Cerottini JC, Horvath C, et al. Distinction of virgin and memory T lymphocytes. Stable acquisition of the Pgp-1 glycoprotein concomitant with antigenic stimulation. J Immunol. 1987; 138(10):3120-3129. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting, Immunoprecipitation). View Reference
  3. Camp RL, Scheynius A, Johansson C, Pure E. CD44 is necessary for optimal contact allergic responses but is not required for normal leukocyte extravasation. J Exp Med. 1993; 178(2):497-507. (Clone-specific: Induction, Inhibition, Radioimmunoassay). View Reference
  4. Ernst DN, Weigle WO, Noonan DJ, McQuitty DN, Hobbs MV. The age-associated increase in IFN-γ synthesis by mouse CD8+ T cells correlates with shifts in the frequencies of cell subsets defined by membrane CD44, CD45RB, 3G11, and MEL-14 expression. J Immunol. 1993; 151(2):575-587. (Clone-specific: Flow cytometry). View Reference
  5. Godfrey DI, Kennedy J, Suda T, Zlotnik A. A developmental pathway involving four phenotypically and functionally distinct subsets of CD3-CD4-CD8- triple-negative adult mouse thymocytes defined by CD44 and CD25 expression. J Immunol. 1993; 150(10):4244-4252. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
  6. Hathcock KS, Hirano H, Murakami S, Hodes RJ. CD44 expression on activated B cells. Differential capacity for CD44-dependent binding to hyaluronic acid. J Immunol. 1993; 151(12):6712-6722. (Clone-specific: Flow cytometry, Immunoprecipitation). View Reference
  7. Hyman R, Lesley J, Schulte R, Trotter J. Progenitor cells in the thymus: most thymus-homing progenitor cells in the adult mouse thymus bear Pgp-1 glycoprotein but not interleukin-2 receptor on their cell surface. Cell Immunol. 1986; 101(2):320-327. (Clone-specific: Flow cytometry). View Reference
  8. Katoh S, McCarthy JB, Kincade PW. Characterization of soluble CD44 in the circulation of mice. Levels are affected by immune activity and tumor growth. J Immunol. 1994; 153(8):3440-3449. (Clone-specific: ELISA). View Reference
  9. Katoh S, Zheng Z, Oritani K, Shimozato T, Kincade PW. Glycosylation of CD44 negatively regulates its recognition of hyaluronan. J Exp Med. 1995; 182(2):419-429. (Clone-specific: Blocking). View Reference
  10. Lesley J, Hyman R, Kincade PW. CD44 and its interaction with extracellular matrix. Adv Immunol. 1993; 54:271-335. (Biology). View Reference
  11. Lesley J, Trowbridge IS. Genetic characterization of a polymorphic murine cell-surface glycoprotein. Immunogenetics. 1982; 15(3):313-320. (Immunogen: Flow cytometry, Immunoprecipitation). View Reference
  12. Lynch F, Ceredig R. Mouse strain variation in Ly-24 (Pgp-1) expression by peripheral T cells and thymocytes: implications for T cell differentiation. Eur J Immunol. 1989; 19(2):223-229. (Clone-specific: Flow cytometry). View Reference
  13. MacDonald HR, Budd RC, Cerottini JC. Pgp-1 (Ly 24) as a marker of murine memory T lymphocytes. Curr Top Microbiol Immunol. 1990; 159:97-109. (Biology). View Reference
  14. Matsumoto G, Nghiem MP, Nozaki N, Schmits R, Penninger JM. Cooperation between CD44 and LFA-1/CD11a adhesion receptors in lymphokine-activated killer cell cytotoxicity. J Immunol. 1998; 160(12):5781-5789. (Clone-specific: Flow cytometry). View Reference
  15. Naor D, Sionov RV, Ish-Shalom D. CD44: structure, function, and association with the malignant process. Adv Cancer Res. 1997; 71:241-319. (Biology). View Reference
  16. Nedvetzki S, Walmsley M, Alpert E, Williams RO, Feldmann M, Naor D. CD44 involvement in experimental collagen-induced arthritis (CIA). J Autoimmun. 1999; 13(1):39-47. (Clone-specific: Blocking). View Reference
  17. Trowbridge IS, Lesley J, Schulte R, Hyman R, Trotter J. Biochemical characterization and cellular distribution of a polymorphic, murine cell-surface glycoprotein expressed on lymphoid tissues. Immunogenetics. 1982; 15:299-312. (Immunogen: Cytotoxicity, Immunoprecipitation). View Reference
  18. Vremec D, Zorbas M, Scollay R, et al. The surface phenotype of dendritic cells purified from mouse thymus and spleen: investigation of the CD8 expression by a subpopulation of dendritic cells. J Exp Med. 1992; 176(1):47-58. (Clone-specific: Flow cytometry). View Reference
View All (18) View Less
940114 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.