Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD38

BD™ AbSeq Oligo Rat Anti-Mouse CD38

Clone 90/CD38 (also known as Ab90) (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
ADP-ribosyl cyclase 1; Cyclic ADP-ribose hydrolase 1; I-19; NIM-R5
12494
2 µl
Rat IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GATGGACGAAATATAGGAGGGCGAGGTTACGGTTGT
AMM2058
Mouse Bone Marrow Pre-B cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940162 Rev. 2
Antibody Details
Down Arrow Up Arrow
90/CD38

The 90 monoclonal antibody specifically binds to CD38, a 42 kDa transmembrane glycoprotein on immature and mature, resting and activated, B lymphocytes. In contrast to humans, CD38 expression is down-regulated on mouse germinal center B cells and plasma cells. CD38 is also expressed on a subpopulation of thymic and peripheral T cells, NK cells, and splenic macrophages. Furthermore, CD38 has been detected on bone marrow-derived hematopoietic stem cells. The CD38 molecule is reported to exhibit both cyclase and hydrolase activities and plays a role in lymphocyte activation. CD31, both human and mouse, is reported to be a ligand for human CD38.

940162 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940162 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940162" on CiteAb

Development References (11)

  1. BD Biosciences Pharmingen. Unpublished results. .
  2. Bean AG, Godfrey DI, Ferlin WG, et al. CD38 expression on mouse T cells: CD38 defines functionally distinct subsets of alpha beta TCR+CD4-CD8- thymocytes. Int Immunol. 1995; 7(2):213-221. (Biology). View Reference
  3. Cockayne DA, Muchamuel T, Grimaldi JC, et al. Mice deficient for the ecto-nicotinamide adenine dinucleotide glycohydrolase CD38 exhibit altered humoral immune responses. Blood. 1998; 92(4):1324-1333. (Biology). View Reference
  4. Deaglio S, Morra M, Mallone R, et al. Human CD38 (ADP-ribosyl cyclase) is a counter-receptor of CD31, an Ig superfamily member. J Immunol. 1998; 160(1):395-402. (Biology). View Reference
  5. Erickson LD, Vogel LA, Cascalho M, et al. B cell immunopoiesis: visualizing the impact of CD40 engagement on the course of T cell-independent immune responses in an Ig transgenic system. Eur J Immunol. 2000; 30(11):3121-3131. (Clone-specific: Flow cytometry, Immunofluorescence). View Reference
  6. Horenstein AL, Stockinger H, Imhof BA, Malavasi F. CD38 binding to human myeloid cells is mediated by mouse and human CD31. Biochem J. 1998; 330(3):1129-1135. (Biology). View Reference
  7. Howard M, Grimaldi JC, Bazan JF, et al. Formation and hydrolysis of cyclic ADP-ribose catalyzed by lymphocyte antigen CD38. Science. 1993; 262(5136):1056-1059. (Biology). View Reference
  8. Lund F, Solvason N, Grimaldi JC, Parkhouse RM, Howard M. Murine CD38: an immunoregulatory ectoenzyme. Immunol Today. 1995; 16(10):469-473. (Biology). View Reference
  9. Oliver AM, Martin F, Kearney JF. Mouse CD38 is down-regulated on germinal center B cells and mature plasma cells. J Immunol. 1997; 158(3):1108-1115. (Immunogen: ELISA, Flow cytometry, Fluorescence activated cell sorting, IC/FCM Block, Immunofluorescence, Immunoprecipitation). View Reference
  10. Oliver AM. Personal Communication. .
  11. Randall TD, Lund FE, Howard MC, Weissman IL. Expression of murine CD38 defines a population of long-term reconstituting hematopoietic stem cells. Blood. 1996; 87(10):4057-4067. (Biology). View Reference
View All (11) View Less
940162 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.