Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD370 (Clec9A)

BD™ AbSeq Oligo Rat Anti-Mouse CD370 (Clec9A)

Clone 10B4 (also known as 24/04-10B4) (RUO)

940340
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
CD370; CLC9A; Clec9a; DNGR-1; C-type lectin domain family 9 member A
232414
2 µl
Rat WI, also known as Wistar (outbred) IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATTGTATTACGTTGAAGTGTGGTCGGCGCAGTGTTT
AMM2128
Mouse Clec9A Peptide
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940340 Rev. 2
Antibody Details
Down Arrow
10B4

The 10B4 monoclonal antibody specifically binds to mouse Clec9A. Mouse Clec9A (C-type lectin domain family member 9A) is also known as DNGR1 (Dendritic cell natural killer lectin group receptor 1). It is a type II membrane protein with a single extracellular C-type lectin domain. Clec9A is a dendritic cell subtype-restricted C-type lectin-like receptor. Clec9A is selectively expressed on plasmacytoid dendritic cells and CD8+ myeloid dendritic cells. Clec9A reportedly serves as a receptor for necrotic cells. It can mediate the cross-presentation of dead-cell associated antigens in a Syk-dependent manner.

940340 Rev. 2
Citations & References
Down Arrow

Development References (1)

  1. Caminschi L, Proietto AL, Ahmet F, et al. The dendritic cell subtype restricted C-type lectin Clec9A is a target for vaccine enhancement. Blood. 2008; 112(8):3264-3273. (Immunogen: Flow cytometry, Functional assay, Immunohistochemistry, In vivo exacerbation). View Reference
940340 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.