Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD35

BD™ AbSeq Oligo Rat Anti-Mouse CD35

Clone 8C12 (RUO)

940351
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
CR1, CD21b
12902
2 µl
Rat SD, also known as Sprague-Dawley (outbred) IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGTGTCAGCGTAATGTAGTGCCGGATATAAAGTCGT
AMM2088
Purified mouse CR1
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940192 Rev. 2
Antibody Details
Down Arrow
8C12

The 8C12 antibody recognizes an epitope present on the 190-kDa complement  receptor protein, originally designated CR1 (CD35), but not the 145-150-kDa CR2 (CD21) molecule.  Unlike the human system, in which these proteins are products of independent genes, both of these mouse receptors are membrane  proteins resulting from the alternative splicing of mRNA transcribed from the Cr2 gene.  Therefore, an alternative nomenclature has been proposed, designating the proteins Cr2-190 (CD21b) and Cr2-145 (CD21a), respectively.  The epitope recognized by 8C12 mAb is only present on CD35/CD21b.   Moreover, it has also been proposed that Crry is the true mouse genetic homologue of human CR1 (CD35).  In the mouse, CD35 is expressed on the majority of peripheral B cells, on the majority of resident peritoneal macrophages, on peripheral blood granulocytes after treatment with N-formyl-Met-Leu-Phe, and on follicular dendritic cells, but not on thymocytes, T cells, erythrocytes, or platelets.  In addition, it has not been detected, at the protein or mRNA level, in the macrophage cell line J774, bone marrow-derived macrophages, or thioglycollate-elicited peritoneal macrophages.  The 8C12 mAb has been reported to inhibit rosette formation by C3bbearing sheep erythrocytes,  to block the complement-dependent trapping of immune complexes by follicular dendritic cells,  and to down-regulate mouse CD35 expression upon in vivo application,  inhibiting only some primary antibody responses to immunization.  B lymphocytes of Cr2[null] mice display impaired humoral immune responses in vivo.  The 8C12 mAb recognizes an epitope on mouse CD35 distinct from the epitope recognized by anti-mouse CD21/CD35 mAb 7G6, and it does not block binding by 7G6 mAb to CD35.

*Please note that the isotype of 8C12 mAb was originally reported to be Rat IgG2c. Further investigations have demonstrated that the isotype of 8C12 mAb is Rat IgG2a.

940192 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940192 Rev.2
Citations & References
Down Arrow

Development References (11)

  1. Ahearn JM, Fischer MB, Croix D, et al. Disruption of the Cr2 locus results in a reduction in B-1a cells and in an impaired B cell response to T-dependent antigen. Immunity. 1996; 4(3):251-262. (Biology). View Reference
  2. Fischer MB, Goerg S, Shen L, et al. Dependence of germinal center B cells on expression of CD21/CD35 for survival. Science. 1998; 280(5363):582-585. (Biology). View Reference
  3. Heyman B, Wiersma EJ, Kinoshita T. In vivo inhibition of the antibody response by a complement receptor-specific monoclonal antibody. J Exp Med. 1990; 172(2):665-668. (Clone-specific: Blocking). View Reference
  4. Hu H, Martin BK, Weis JJ, Weis JH. Expression of the murine CD21 gene is regulated by promoter and intronic sequences. J Immunol. 1997; 158(10):4758-4768. (Biology). View Reference
  5. Kinoshita T, Takeda J, Hong K, Kozono H, Sakai H, Inoue K. Monoclonal antibodies to mouse complement receptor type 1 (CR1). Their use in a distribution study showing that mouse erythrocytes and platelets are CR1-negative. J Immunol. 1988; 140(9):3066-3072. (Immunogen: Blocking, Immunoprecipitation). View Reference
  6. Kinoshita T, Thyphronitis G, Tsokos GC, et al. Characterization of murine complement receptor type 2 and its immunological cross-reactivity with type 1 receptor. Int Immunol. 1990; 2(7):651-659. (Clone-specific: Blocking, Western blot). View Reference
  7. Kurtz CB, O'Toole E, Christensen SM, Weis JH. The murine complement receptor gene family. IV. Alternative splicing of Cr2 gene transcripts predicts two distinct gene products that share homologous domains with both human CR2 and CR1. J Immunol. 1990; 144(9):3581-3591. (Biology). View Reference
  8. Martin BK, Weis JH. Murine macrophages lack expression of the Cr2-145 (CR2) and Cr2-190 (CR1) gene products. Eur J Immunol. 1993; 23(11):3037-3042. (Biology). View Reference
  9. Molina H, Holers VM, Li B, et al. Markedly impaired humoral immune response in mice deficient in complement receptors 1 and 2. Proc Natl Acad Sci U S A. 1996; 93(8):3357-3361. (Biology). View Reference
  10. Wiersma EJ, Kinoshita T, Heyman B. Inhibition of immunological memory and T-independent humoral responses by monoclonal antibodies specific for murine complement receptors. Eur J Immunol. 1991; 21(10):2501-2506. (Clone-specific: Blocking). View Reference
  11. Yoshida K, van den Berg TK, Dijkstra CD. Two functionally different follicular dendritic cells in secondary lymphoid follicles of mouse spleen, as revealed by CR1/2 and FcR gamma II-mediated immune-complex trapping. Immunology. 1993; 80(1):34-39. (Clone-specific: Blocking). View Reference
View All (11) View Less
940192 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.