Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD268 (BAFF-R)

BD™ AbSeq Oligo Rat Anti-Mouse CD268 (BAFF-R)

Clone 7H22-E16 (RUO)

940330
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
Tnfrsf13c; TR13C; BAFF-R; Baffr; Bcmd; Bcmd-1; BLyS receptor 3; Br3; Lvis22
72049
2 µl
Rat WI, also known as Wistar (outbred) IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTCCGTGAGATGTAGCGAGCGATAGCAATTTGGGTT
AMM2114
Mouse BAFF-R Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940330 Rev. 2
Antibody Details
Down Arrow
7H22-E16

The 7H22-E16 monoclonal antibody specifically binds to CD268, which is also known as, B cell-activating factor receptor (BAFF-R), or BAFF Receptor 3 (BR3). CD268 is a type III transmembrane protein that is likewise known as Tumor necrosis factor receptor superfamily member 13C (Tnfrsf13c). CD268/BAFF-R is a receptor for CD257 (also known as, BAFF, Blys, TALL-1, or THANK) and is expressed on B cells and a subset of activated/memory CD4+ T cells. B cells express two other BAFF receptors, CD267/TACI, or CD269/BCMA, at various times during their differentiation. CD268/BAFF-R expression starts at the transitional stage of B cell development and increases throughout B cell maturation. CD267/BAFF-R mediates most BAFF-dependent functions including B cell survival, the activation of B cell proliferation and immunoglobulin secretion, and the costimulation of T cells. Overexpression of BAFF in mice and humans is associated with autoimmunity, whereas CD268/BAFF-R deficiency may cause severe impairment in humoral responses.

940330 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940330 Rev.2
Citations & References
Down Arrow

Development References (3)

  1. Giltiay NV, Lu Y, Allman D, Jørgensen TN, Li X. The adaptor molecule Act1 regulates BAFF responsiveness and self-reactive B cell selection during transitional B cell maturation.. J Immunol. 2010; 185(1):99-109. (Clone-specific: Flow cytometry). View Reference
  2. Naradikian MS, Perate AR, Cancro MP. BAFF receptors and ligands create independent homeostatic niches for B cell subsets.. Curr Opin Immunol. 2015; 34:126-129. (Biology). View Reference
  3. Ng LG, Sutherland AP, Newton R, et al. B cell-activating factor belonging to the TNF family (BAFF)-R is the principal BAFF receptor facilitating BAFF costimulation of circulating T and B cells.. J Immunol. 2004; 173(2):807-17. (Immunogen: Flow cytometry). View Reference
940330 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.