Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD267 (TACI)

BD™ AbSeq Oligo Rat Anti-Mouse CD267 (TACI)

Clone 8F10

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
TACI; Taci;Tnfrsf13b; transmembrane activator and CAML interactor
57916
2 µl
Rat WF, also known as Wistar Furth IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGCTGAATGGTAATGCACGGTGGTCGGTTGATATGT
AMM2234
Mouse TACI Extracellular Domain Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940455 Rev. 2
Antibody Details
Down Arrow Up Arrow
8F10

The 8F10 monoclonal antibody specifically recognizes CD267 which is also known as transmembrane activator and calcium-modulating and cyclophilin ligand interactor(transmembrane activator and CAML interactor or TACI). CD267 is encoded by Tnfrsf13b (tumor necrosis factor receptor superfamily member 13B). CD267 is a type III transmembrane protein receptor that binds to the ligands BAFF (BLyS), and APRIL. BAFF overproduction is associated with lupus erythematosus and Sjögren's disease, two systemic autoimmune diseases. CD267 is expressed most notably on maturing subsets of splenic B cells such as transition type 2 (T2) and marginal zone (MZ) B cells and also in activated T-cells. In CD267 deficient mice, B cell numbers are increased and mice develop autoimmune disorders suggesting that CD267 plays a role in B cell regulation.

940455 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940455 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (4)

  1. Ng LG, Sutherland AP, Newton R, et al. B cell-activating factor belonging to the TNF family (BAFF)-R is the principal BAFF receptor facilitating BAFF costimulation of circulating T and B cells.. J Immunol. 2004; 173(2):807-17. (Immunogen: Flow cytometry). View Reference
  2. Siegel RM, Lenardo MJ.. To B or not to B: TNF family signaling in lymphocytes. Nat Immunol. 2001; 2(7):577-578. (Biology). View Reference
  3. Yan M, Wang H, Chan B, et al. Activation and accumulation of B cells in TACI-deficient mice.. Nat Immunol. 2001; 2(7):638-43. (Biology). View Reference
  4. von Bülow GU, Bram RJ. NF-AT activation induced by a CAML-interacting member of the tumor necrosis factor receptor superfamily. Science. 1997; 278(5335):138-141. (Biology). View Reference
940455 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.