Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD195

BD™ AbSeq Oligo Rat Anti-Mouse CD195

Clone C34-3448

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Ccr5; chemokine (C-C) receptor 5; C-C CKR-5; CC-CKR-5; CCR-5; AM4-7
2 µl
Rat IgG2c, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGTGATATAGTAGCTTAAGGTGGGCGGTTGGTTCTC
AMM2250
Mouse CCR5 aa. 9-30
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. Please refer to bd.com/genomics-resources for technical protocols.
  6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940498 Rev. 2
Antibody Details
Down Arrow Up Arrow
C34-3448

The C34-3448 monoclonal antibody specifically binds to CD195 which is also known as, C-C chemokine receptor type 5 (CCR5). CD195 is a seven transmembrane-spanning G-protein-coupled receptor that belongs to the β-chemokine receptor family. CD195 regulates lymphocyte chemotaxis activation and transendothelial migration during inflammation. It signals in response to at least three chemokines: CCL3/MIP-1α, CCL4/MIP-1β, and CCL5/RANTES. CD195 is expressed on macrophages and some T-lymphocytes.

940498 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940498 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (10)

  1. Boring L, Gosling J, Monteclaro FS, Lusis AJ, Tsou CL, Charo IF. Molecular cloning and functional expression of murine JE (monocyte chemoattractant protein 1) and murine macrophage inflammatory protein 1alpha receptors: evidence for two closely linked C-C chemokine receptors on chromosome 9. J Biol Chem. 1996; 271(13):7551-7558. (Biology). View Reference
  2. Hayakawa Y, Smyth MJ. CD27 dissects mature NK cells into two subsets with distinct responsiveness and migratory capacity. J Immunol. 2006; 176(3):1517-1524. (Clone-specific: Flow cytometry). View Reference
  3. Kim SH, Cleary MM, Fox HS, Chantry D, Sarvetnick N. CCR4-bearing T cells participate in autoimmune diabetes. J Clin Invest. 2002; 110(11):1675-1686. (Clone-specific: Flow cytometry). View Reference
  4. McGuirk P, McCann C, Mills KH. Pathogen-specific T regulatory 1 cells induced in the respiratory tract by a bacterial molecule that stimulates interleukin 10 production by dendritic cells: a novel strategy for evasion of protective T helper type 1 responses by Bordetella pertussis. J Exp Med. 2002; 195(2):221-231. (Clone-specific: Flow cytometry). View Reference
  5. McLoughlin RM, Jenkins BJ, Grail D, et al. IL-6 trans-signaling via STAT3 directs T cell infiltration in acute inflammation. Proc Natl Acad Sci U S A. 2005; 102(27):9589-9594. (Clone-specific: Flow cytometry). View Reference
  6. Meyer A, Coyle AJ, Proudfoot AE, Wells TN, Power CA. Cloning and characterization of a novel murine macrophage inflammatory protein-1 alpha receptor. J Biol Chem. 1996; 271(24):14445-14451. (Biology). View Reference
  7. Nakae S, Iwakura Y, Suto H, Galli SJ. Phenotypic differences between Th1 and Th17 cells and negative regulation of Th1 cell differentiation by IL-17. J Leukoc Biol. 2007; 81(5):1258-1268. (Clone-specific: Flow cytometry). View Reference
  8. Napolitano M, Seamon KB, Leonard WJ. Identification of cell surface receptors for the Act-2 cytokine. J Exp Med. 1990; 172(1):285-289. (Biology). View Reference
  9. Zozulya AL, Reinke E, Baiu DC, Karman J, Sandor M, Fabry Z. Dendritic cell transmigration through brain microvessel endothelium is regulated by MIP-1alpha chemokine and matrix metalloproteinases. J Immunol. 2007; 178(1):520-529. (Clone-specific: Flow cytometry). View Reference
  10. van Deventer HW, Wu QP, Bergstralh DT, et al. C-C chemokine receptor 5 on pulmonary fibrocytes facilitates migration and promotes metastasis via matrix metalloproteinase 9. Am J Pathol. 2008; 173(1):253-264. (Clone-specific: Flow cytometry). View Reference
View All (10) View Less
940498 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.