Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD138

BD™ AbSeq Oligo Rat Anti-Mouse CD138

Clone 281-2

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
SYND1; Syndecan-1; syn-1; Sdc1; Sstn; synstatin
20969
2 µl
Rat F344, also known as Fischer, CDF IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GAGCGGGCAAGATAGTTTAGTTAGCGAGTAGATAGT
AMM2033
NAMRU mouse mammary gland epithelial cell line NMuMG
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940137 Rev. 2
Antibody Details
Down Arrow Up Arrow
281-2

The 281-2 monoclonal antibody specifically binds to the core protein of CD138 (Syndecan-1), a cell-surface, integral membrane heparan sulfate- and chondroitin sulfate-containing proteoglycan that binds to interstitial extracellular matrix molecules.  Syndecan-1 is predominantly expressed on epithelial cells, where its expression correlates with normal epithelial organization.  It is also expressed on B lymphocytes at specific stages during their differentiation: precursor B cells in the bone marrow, and antibody-secreting cells including plasma cells (but not mature peripheral B cells).  It is thus implicated in mediating B cell-matrix interactions.  CD138 expression is also regulated during embryonic development, and the molecule shows a tissue- specific structural polymorphism resulting from different post-translational  modifications.  The 281-2 antibody may be used to detect the differently glycosylated forms, because it reacts with the core protein.  Furthermore, the mAb detects the Syndecan-1 ectodomain which is cleaved from cell surfaces by a metalloproteinase.

940137 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940137 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (10)

  1. Bernfield M, Kokenyesi R, Kato M, et al. Biology of the syndecans: a family of transmembrane heparan sulfate proteoglycans. Annu Rev Cell Biol. 1992; 8:365-393. (Biology). View Reference
  2. Driver DJ, McHeyzer-Williams LJ, Cool M, Stetson DB, McHeyzer-Williams MG. Development and maintenance of a B220- memory B cell compartment. J Immunol. 2001; 167(3):1393-1405. (Clone-specific: Flow cytometry, Fluorescence microscopy, Immunofluorescence). View Reference
  3. Fitzgerald ML, Wang Z, Park PW, Murphy G, Bernfield M. Shedding of syndecan-1 and -4 ectodomains is regulated by multiple signaling pathways and mediated by a TIMP-3-sensitive metalloproteinase. J Cell Biol. 2000; 148(4):811-824. (Clone-specific: Dot Blot, Fluorescence microscopy, Immunofluorescence). View Reference
  4. Hayashi K, Hayashi M, Jalkanen M, Firestone JH, Trelstad RL, Bernfield M. Immunocytochemistry of cell surface heparan sulfate proteoglycan in mouse tissues. A light and electron microscopic study. J Histochem Cytochem. 1987; 35(10):1079-1088. (Clone-specific: Immunohistochemistry). View Reference
  5. Jalkanen M, Nguyen H, Rapraeger A, Kurn N, Bernfield M. Heparan sulfate proteoglycans from mouse mammary epithelial cells: localization on the cell surface with a monoclonal antibody. J Cell Biol. 1985; 101(3):976-984. (Immunogen: Dot Blot, ELISA, Fluorescence microscopy, Immunofluorescence, Radioimmunoassay, Western blot). View Reference
  6. Lalor PA, Nossal GJ, Sanderson RD, McHeyzer-Williams MG. Functional and molecular characterization of single, (4-hydroxy-3-nitrophenyl)acetyl (NP)-specific, IgG1+ B cells from antibody-secreting and memory B cell pathways in the C57BL/6 immune response to NP. Eur J Immunol. 1992; 22(11):3001-3011. (Biology: Western blot). View Reference
  7. Sanderson RD, Lalor P, Bernfield M. B lymphocytes express and lose syndecan at specific stages of differentiation. Cell Regul. 1989; 1(1):27-35. (Clone-specific: Flow cytometry, Immunoaffinity chromatography, Immunohistochemistry, Western blot). View Reference
  8. Sanderson RD, Sneed TB, Young LA, Sullivan GL, Lander AD. Adhesion of B lymphoid (MPC-11) cells to type I collagen is mediated by integral membrane proteoglycan, syndecan. J Immunol. 1992; 148(12):3902-3911. (Clone-specific: Immunoaffinity chromatography, Radioimmunoassay). View Reference
  9. Saunders S, Jalkanen M, O'Farrell S, Bernfield M. Molecular cloning of syndecan, an integral membrane proteoglycan. J Cell Biol. 1989; 108(4):1547-1556. (Clone-specific). View Reference
  10. Wehrli N, Legler DF, Finke D. Changing responsiveness to chemokines allows medullary plasmablasts to leave lymph nodes. Eur J Immunol. 2001; 31(2):609-616. (Biology: Immunohistochemistry). View Reference
View All (10) View Less
940137 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.