Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD125

BD™ AbSeq Oligo Rat Anti-Mouse CD125

Clone T21 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Il5r; Il5ra; IL-5RA; IL-5Rα; IL-5R-alpha; IL-5R subunit alpha
2 µl
Rat WI, also known as Wistar (outbred) IgG1, λ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAGTGGAGTTGCGAAGGTTGGGCGATAAGTAAGTTT
AMM2108
Mouse T88-M Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940324 Rev. 2
Antibody Details
Down Arrow Up Arrow
T21

The T21 monoclonal antibody specifically binds to CD125 which is also known as the alpha subunit of the IL-5 Receptor (IL5RA/IL-5Rα).  CD125 is a type I transmembrane protein that belongs to the hemopoietin receptor and Ig gene superfamilies. It is expressed on B cells and eosinophils. CD125 associates with the Common β chain (βc/Bc) subunit, also known as CD131, to form the functional IL-5 Receptor complex. Mouse IL-5 belongs to the hematopoietic growth factor family of cytokines and promotes the growth and differentiation of B cells and eosinophils. Upon binding, the T21 antibody blocks IL-5 binding to its receptor and can inhibit IL-5 induced B-cell proliferation and antibody production.

940324 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940324 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940324" on CiteAb

Development References (5)

  1. Adachi T, Alam R.. The mechanism of IL-5 signal transduction. Am J Physiol. 275(3 Pt 1):C623-C633. (Biology). View Reference
  2. Dyer KD, Garcia-Crespo KE, Percopo CM, et al. Defective eosinophil hematopoiesis ex vivo in inbred Rocky Mountain White (IRW) mice. J Leukoc Biol. 2011; 90(6):1101-1109. (Clone-specific: Flow cytometry). View Reference
  3. Hitoshi Y, Yamaguchi N, Mita S, et al. Distribution of IL-5 receptor-positive cells. Expression of IL-5 receptor in Ly-1 (CD5)+ B cells.. J Immunol. 1990; 144(11):4218-4225. (Immunogen: Blocking, Flow cytometry, Functional assay, Immunoprecipitation, Inhibition, Radioimmunoassay). View Reference
  4. Takaki S, Tominaga A, Hitoshi Y, et al. Molecular cloning and expression of the murine interleukin-5 receptor. EMBO J. 1990; 9(13):4367-4374. (Clone-specific: Cell separation, Flow cytometry). View Reference
  5. Wetzel, GD. Interleukin 5 regulation of peritoneal Ly-1 B lymphocyte proliferation, differentiation, and autoantibody secretion. Eur J Immunol. 1989; 19(9):1701-1707. (Biology). View Reference
940324 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.