Skip to main content Skip to navigation
Oligo Mouse Anti-Mouse Ly-108

BD™ AbSeq Oligo Mouse Anti-Mouse Ly-108

Clone 13G3 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD352; Slamf6; SLAM family member 6; KAL1; NTB-A; SF2000
30925
2 µl
Mouse IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTAGAGGCTTATTTGAGTGGTGTTATTCGCGTATCG
AMM2141
WT thymocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940406 Rev. 2
Antibody Details
Down Arrow Up Arrow
13G3

The 13G3 monoclonal antibody specifically binds to Lymphocyte antigen 108, Ly-108. Ly-108 is a member of the signaling lymphocytic activation molecule (SLAM) family of immune receptors. Ly-108 is a type 1 transmembrane glycoprotein adhesion receptor that is expressed by T cells, NKT cells, B cells, NK cells, macrophages, dendritic cells and neutrophils. Ly-108 plays multiple roles in innate and adaptive immunity including costimulation of NK cell cytotoxicity and T cell cytokine responses. Moreover, Ly-108 has been implicated in autoimmunity.

940406 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940406 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940406" on CiteAb

Development References (5)

  1. Griewank K, C Borowski, Rietdijk S, et al. Homotypic interactions mediated by Slamf1 and Slamf6 receptors control NKT cell lineage development. Immunity. 2007; 27(5):751-762. (Clone-specific: Flow cytometry, Immunofluorescence). View Reference
  2. Howie D, Laroux FS, Morra M, et al. Cutting edge: the SLAM family receptor Ly108 controls T cell and neutrophil functions. J Immunol. 2005; 10(174):5931-5935. (Biology). View Reference
  3. Keszei M, Detre C, Rietdijk ST, et al. A novel isoform of the Ly108 gene ameliorates murine lupus.. J Exp Med. 2011; 208(4):811-22. (Immunogen: ELISA, Flow cytometry, Immunoprecipitation). View Reference
  4. Li W, Sofi MH, Rietdijk S, Wang N, et al. The SLAM-Associated Protein (SAP)/Fyn/PKCθ Pathway is Required for Thymocyte-mediated CD4 T Cell Development. Immunity. 2007; 27(2):763-774. (Biology). View Reference
  5. Peck SR, Ruley HE. Ly108: a new member of the mouse CD2 family of cell surface proteins. J Immunol. 2000; 52(1-2):63-72. (Biology). View Reference
940406 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.