Skip to main content Skip to navigation
Oligo Mouse Anti-Human FcRL6

BD™ AbSeq Oligo Mouse Anti-Human FcRL6

Clone 2H3 (RUO)

Sign In
25 Tests
Product Details
Down Arrow


BD™ AbSeq
Fc receptor-like protein 6; FcRH6; IFGP6; IgSF type I transmembrane receptor; fc receptor homolog 6; fcR-like protein 6
343413
2 µl
Mouse BALB/c IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGGTCAGATTGTCGATTTAGGCCGTTTGGTGTTAGG
AHS0256
Human FCRL6 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

940379 Rev. 1
Antibody Details
Down Arrow
2H3

The 2H3 monoclonal antibody specifically binds to human Fc receptor-like protein 6 (FCRL6), which is also known as Fc receptor homolog 6 (FcRH6), IFGP family protein 6 (IFGP6) or Immune receptor translocation-associated protein 6 (IRTA6). FCRL6 is a type I transmembrane glycoprotein of the Immunoglobulin (Ig) gene superfamily with 3 extracellular Ig domains. In healthy donors, FCRL6 is expressed by cytolytic CD8-positive T cells and NK cells; its expression is expanded to populations of CD4-positive T cells in HIV-1-positive patients. FCRL6 expression is associated with NK cell maturation. Human FCRL6 binds to HLA-DR, and it has a cytoplasmic immunoreceptor tyrosine-based inhibition motif (ITIM).

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end.  The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

NOTE:  The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.

940379 Rev. 1
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms. NOTE: The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.
Antibody-Oligo
940379 Rev.1
Citations & References
Down Arrow
No Citations Found

No Citations Are Available for this Product

940379 Rev. 1

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.