Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse Vγ1.1 TCR

BD™ AbSeq Oligo Hamster Anti-Mouse Vγ1.1 TCR

Clone 2.11 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
TCR V gamma 1.1; TCR Vg1.1; TCR V-gamma-1; TCR Vg1; Cr4
107692
2 µl
Armenian Hamster IgG
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTAGTATGAGCCTGAATTGCGATGACGTTGCGGGTT
AMM2118
Mouse TCR γδ+ T3.13.1 hybridoma cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
  8. Please refer to bd.com/genomics-resources for technical protocols.
  9. For U.S. patents that may apply, see bd.com/patents.
940334 Rev. 2
Antibody Details
Down Arrow Up Arrow
2.11

The 2.11 monoclonal antibody recognizes the Vγ1.1 chain of the heterodimeric γδ T-cell receptor (TCR γδ) expressed by T lymphocytes and NK-T cells. It does not react with TCR αβ-bearing T cells. TCR γδ associates with CD3 molecules to form the TCR γδ/CD3 complex that mediates antigen recognition and can transduce intracellular signals leading to T cell responses. The Vγ1.1 TCR is also known as Vγ1 TCR. The Vγ1.1 variable region TCR gene segment primarily rearranges to join the Jγ4 and Cγ4 TCR gene segments. TCR Vγ1-expressing cells represent a major population of TCR γδ cells in the adult mouse thymus, peripheral lymphoid tissues, and different epithelia. They constitute a minor population of TCR γδ-positive T cells during fetal and early postnatal life.

940334 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940334 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940334" on CiteAb

Development References (4)

  1. Cui ZH, Joetham A, Aydintug MK, Hahn YS, Born WK, Gelfand EW. Reversal of allergic airway hyperreactivity after long-term allergen challenge depends on gammadelta T cells.. Am J Respir Crit Care Med. 2003; 168(11):1324-32. (Clone-specific: Cell separation, Depletion). View Reference
  2. Matsubara S, Takeda K, Jin N, et al. Vgamma1+ T cells and tumor necrosis factor-alpha in ozone-induced airway hyperresponsiveness.. Am J Respir Cell Mol Biol. 2009; 40(4):454-63. (Clone-specific: Flow cytometry). View Reference
  3. Pereira P, Gerber D, Huang SY, Tonegawa S. Ontogenic development and tissue distribution of V gamma 1-expressing gamma/delta T lymphocytes in normal mice.. J Exp Med. 1995; 182(6):1921-30. (Immunogen: Flow cytometry, Functional assay, Immunoprecipitation, Inhibition, Radioimmunoassay). View Reference
  4. Pereira P, Lafaille JJ, Gerber D, Tonegawa S. The T cell receptor repertoire of intestinal intraepithelial gammadelta T lymphocytes is influenced by genes linked to the major histocompatibility complex and to the T cell receptor loci. Proc Natl Acad Sci U S A. 1997; 94(11):5761-5766. (Clone-specific: Flow cytometry). View Reference
940334 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.