Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD48

BD™ AbSeq Oligo Hamster Anti-Mouse CD48

Clone HM48-1

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
BLAST; BLAST-1; BCM1; HM48-1; MEM-102; Sgp-60; SLAMF2
12506
2 µl
Armenian Hamster IgG1, λ3
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTCTGGGCGTTTGGTAGTCGGCTGATTTATATGAGT
AMM2064
Mouse T lymphoma MBL-2
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940168 Rev. 2
Antibody Details
Down Arrow Up Arrow
HM48-1

The HM48-1 monoclonal antibody specifically binds to CD48 (previously known as BCM1 in mice, Blast-1 in human, and OX-45 in the rat), a GPI-anchored member of the Ig superfamily. It is widely distributed on leukocytes, but not on non-hematopoietic cells, and its ligands include CD2 (LFA-2) and CD244 (2B4 antigen). The HM48-1 mAb blocks binding of soluble CD2 to CD48-bearing cells, blocks the interaction of CD2 and CD244, inhibits spleen cell proliferative responses to mitogens, augments the proliferative response of spleen cells when cross-linked with anti-CD3e mAbs, and inhibits priming of CTL in vitro. In vivo administration of HM48-1 antibody can prolong survival of cardiac allografts, an effect which is greatly enhanced by the addition of anti-CD2 mAb 12-15. This hamster mAb to a mouse leukocyte antigen does not cross-react with rat leukocytes.

940168 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940168 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (5)

  1. Brown MH, Boles K, van der Merwe PA, Kumar V, Mathew PA, Barclay AN. 2B4, the natural killer and T cell immunoglobulin superfamily surface protein, is a ligand for CD48. J Exp Med. 1998; 188(11):2083-2090. (Biology). View Reference
  2. Kato K, Koyanagi M, Okada H, et al. CD48 is a counter-receptor for mouse CD2 and is involved in T cell activation. J Exp Med. 1992; 176(5):1241-1249. (Immunogen: Blocking, (Co)-stimulation, ELISA, Immunoprecipitation, Inhibition, Stimulation, Western blot). View Reference
  3. Latchman Y, McKay PF, Reiser H. Identification of the 2B4 molecule as a counter-receptor for CD48. J Immunol. 1998; 161(11):5809-5812. (Biology). View Reference
  4. Qin L, Chavin KD, Lin J, Yagita H, Bromberg JS. Anti-CD2 receptor and anti-CD2 ligand (CD48) antibodies synergize to prolong allograft survival. J Exp Med. 1994; 179(1):341-346. (Biology). View Reference
  5. Wong YW, Williams AF, Kingsmore SF, Seldin MF. Structure, expression, and genetic linkage of the mouse BCM1 (OX45 or Blast-1) antigen. Evidence for genetic duplication giving rise to the BCM1 region on mouse chromosome 1 and the CD2/LFA3 region on mouse chromosome 3. J Exp Med. 1990; 171(6):2115-2130. (Biology). View Reference
940168 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.