Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD28

BD™ AbSeq Oligo Hamster Anti-Mouse CD28

Clone 37.51

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Cd28; CD28 antigen; T-cell-specific surface glycoprotein CD28
12487
2 µl
Syrian Hamster IgG2, λ1
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CGTGGGTTGATTAGCGATTATTATTCCGTTGTTGTC
AMM2016
Mouse EL-4 (T-cell lymphoma) Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Syrian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
  9. For U.S. patents that may apply, see bd.com/patents.
940120 Rev. 3
Antibody Details
Down Arrow Up Arrow
37.51

The 37.51 antibody reacts with CD28, which is expressed on most thymocytes, at low density on nearly all CD4+ and CD8+ peripheral T cells, and at even lower density on NK cells. The expression of CD28, in splenocytes and thymocytes,  has been reported to increase after activation. CD28 transcripts are found in mast cells, and cell-surface expression of CD28 is induced upon maturation or activation of mast cells. It has been reported that CD28 is not expressed on some populations of intraepithelial T lymphocytes. CD28 is a costimulatory receptor; its ligands include CD80 (B7-1) and CD86 (B7-2). The 37.51 mAb augments proliferation and cytokine production by activated T and NK cells and can provide a costimulatory signal for CTL induction. There is considerable evidence that CD28 is a costimulatory receptor involved in many, but not all, T cell-dependent immune responses.

940120 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940120 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (16)

  1. Bluestone JA. New perspectives of CD28-B7-mediated T cell costimulation. Immunity. 1995; 2(6):555-559. (Biology: Apoptosis). View Reference
  2. Cibotti R, Punt JA, Dash KS, Sharrow SO, Singer A. Surface molecules that drive T cell development in vitro in the absence of thymic epithelium and in the absence of lineage-specific signals. Immunity. 1997; 6(3):245-255. (Clone-specific: (Co)-stimulation, Stimulation). View Reference
  3. Gelfanov V, Lai YG, Gelfanova V, Dong JY, Su JP, Liao NS. Differential requirement of CD28 costimulation for activation of murine CD8+ intestinal intraepithelial lymphocyte subsets and lymph node cells. J Immunol. 1995; 155(1):76-82. (Clone-specific: (Co)-stimulation, Flow cytometry, Stimulation). View Reference
  4. Gross JA, Callas E, Allison JP. Identification and distribution of the costimulatory receptor CD28 in the mouse. J Immunol. 1992; 149(2):380-388. (Immunogen: (Co)-stimulation, Flow cytometry, Immunoprecipitation, Stimulation). View Reference
  5. Harding FA, Allison JP. CD28-B7 interactions allow the induction of CD8+ cytotoxic T lymphocytes in the absence of exogenous help. J Exp Med. 1993; 177(6):1791-1796. (Clone-specific: (Co)-stimulation, Inhibition, Stimulation). View Reference
  6. Harding FA, McArthur JG, Gross JA, Raulet DH, Allison JP. CD28-mediated signalling co-stimulates murine T cells and prevents induction of anergy in T-cell clones. Nature. 1992; 356(6370):607-609. (Clone-specific: (Co)-stimulation, Stimulation). View Reference
  7. June CH, Bluestone JA, Nadler LM, Thompson CB. The B7 and CD28 receptor families. Immunol Today. 1994; 15(7):321-331. (Biology). View Reference
  8. Krummel MF, Allison JP. CD28 and CTLA-4 have opposing effects on the response of T cells to stimulation. J Exp Med. 1995; 182(2):459-465. (Clone-specific: (Co)-stimulation, Stimulation). View Reference
  9. Lepesant H, Pierres M, Naquet P. Deficient antigen presentation by thymic epithelial cells reveals differential induction of T cell clone effector functions by CD28-mediated costimulation. Cell Immunol. 1995; 161(2):279-287. (Clone-specific: (Co)-stimulation, Stimulation). View Reference
  10. Marietta EV, Weis JJ, Weis JH. CD28 expression by mouse mast cells is modulated by lipopolysaccharide and outer surface protein A lipoprotein from Borrelia burgdorferi. J Immunol. 1997; 159(6):2840-2848. (Clone-specific: (Co)-stimulation, Flow cytometry, Stimulation). View Reference
  11. Nandi D, Gross JA, Allison JP. CD28-mediated costimulation is necessary for optimal proliferation of murine NK cells. J Immunol. 1994; 152(7):3361-3369. (Clone-specific: (Co)-stimulation, Flow cytometry, Stimulation). View Reference
  12. Nishio M, Spielman J, Lee RK, Nelson DL, Podack ER. CD80 (B7.1) and CD54 (intracellular adhesion molecule-1) induce target cell susceptibility to promiscuous cytotoxic T cell lysis. J Immunol. 1996; 157(10):4347-4353. (Biology). View Reference
  13. Ong CJ, Lim AS, Teh HS. CD28-induced cytokine production and proliferation by thymocytes are differentially regulated by the p59fyn tyrosine kinase. J Immunol. 1997; 159(5):2169-2176. (Clone-specific: (Co)-stimulation, Stimulation). View Reference
  14. Rakasz E, Hagen M, Sandor M, Lynch RG. Gamma delta T cells of the murine vagina: T cell response in vivo in the absence of the expression of CD2 and CD28 molecules. Int Immunol. 1997; 9(1):161-167. (Clone-specific: Flow cytometry). View Reference
  15. Shahinian A, Pfeffer K, Lee KP, et al. Differential T cell costimulatory requirements in CD28-deficient mice. Science. 1993; 261(5121):609-612. (Biology). View Reference
  16. Wells AD, Gudmundsdottir H, Turka LA. Following the fate of individual T cells throughout activation and clonal expansion. Signals from T cell receptor and CD28 differentially regulate the induction and duration of a proliferative response. J Clin Invest. 1997; 100(12):3173-3183. (Clone-specific: (Co)-stimulation, Stimulation). View Reference
View All (16) View Less
940120 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.