Skip to main content Skip to navigation
Oligo Mouse Anti-T-bet

BD® AbSeq Oligo Mouse Anti-T-bet

Clone O4-46 (RUO)

610121
EA (1 Each)
25 Tests
Add Product To QuoteAdd to Quote
Product Details
Down Arrow


BD® AbSeq
T-box expressed in T cells; TBX21; T-box 21; TBLYM
30009, 57765
2 µl/test
Mouse IgG1, κ
Human,Mouse (Tested in Development)
Single Cell 3' Sequencing Intracellular CITE-seq (Tested During Development)
TGTAAAGATGTCGGGCTATGGGTCAGTATGTATTGG
AHS481
Human T-bet Peptide
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for = 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

When using BD® AbSeq intracellular markers with the Single Cell 3' Sequencing Intracellular CITE-seq, cells must first be fixed and permeabilized using the BD Rhapsody™ Intracellular AbSeq Buffer Kit before the antibody-oligo can bind to the protein. Refer to the list of required companion products below and see BD Rhapsody™ System Single-Cell Labelling with BD® AbSeq Ab-Oligos for Intracellular CITE-seq (Doc ID: 23-24464) for the complete BD® AbSeq intracellular multiomics staining protocol. Contact your local Field Application Specialist (FAS) for additional guidance.

Use standard laboratory safety protocols. Read and understand the safety data sheets (SDSs) before handling chemicals. To obtain SDSs, go to regdocs.bd.com or contact BD Biosciences technical support at scomix@bdscomix.bd.com.

Warning: All biological specimens and materials contacting them are considered biohazardous. Handle as if capable of transmitting infection and dispose of with proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves.

Product Notices

  1. Please refer to www.bdbiosciences.com/us/s/resources for technical protocols.
  2. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Species cross-reactivity detected in product development may not have been confirmed on every format and/or application.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. Please refer to bd.com/genomics-resources for technical protocols.
  9. Illumina is a trademark of Illumina, Inc.
  10. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940515 Rev. 2
Antibody Details
Down Arrow
O4-46

The O4-46  monoclonal antibody specifically binds to human and mouse T-bet. T-bet (T-box gene expressed in T cells) is a master regulatory transcription factor that is also known as TBX21 (T-box21) and TBLYM (T-box transcription factor, expressed in lymphocytes). Human (535 amino acids; 58.3 kDa predicted molecular mass) and mouse (530 amino acids; 57.7 kDa) T-bet proteins are encoded by the human TBX21 (chromosome 17) and mouse Tbx21 (chromosome 11) genes. The human and mouse T-bet protein amino acid sequences are 88% homologous. Human and mouse T-bet proteins share a highly conserved (98% homologous amino acid sequences) T-box protein domain that is centrally located and mediates binding to DNA. T-bet is expressed by and activates transcriptional activities within hemotopoietic cells including stem cells,  NK and NKT cells and subsets of thymocytes, primed/activated CD4+ T cells, CD8+ T cells and γδ T cells, B cells, and dendritic cells. Interferon-gamma (IFN-γ), interleukin-27 (IL-27), and IL-12 act on peripheral antigen-triggered (TCR-signaling) T cells to increase T-bet expression. With respect to T helper lymphocytes, T-bet directs the differentiation of naïve CD4+ precursor T cells to become Th1-like effector and memory cells. T-bet accomplishes this by activating Th1 genetic programs (including epigenetic modifications) while repressing opposing T helper subset programs. T-bet controls the upregulated expression of the Th1 signature cytokine, IFN-γ, the IL-12Rβ2 subunit and the Runx3 transcription factor and can repress the function of other transcriptional regulators, such as GATA-3 (master regulator of Th2 development) and the expression of other cytokines including IL-2, IL-4 and IL-5.

940515 Rev. 2
Citations & References
Down Arrow

Development References (8)

  1. Bando JK, Gilfillan S, Di Luccia B, et al. ILC2s are the predominant source of intestinal ILC-derived IL-10.. J Exp Med. 2020; 217(2):e20191520. (Clone-specific: Flow cytometry). View Reference
  2. Cella M, Gamini R, Sécca C, et al. Subsets of ILC3-ILC1-like cells generate a diversity spectrum of innate lymphoid cells in human mucosal tissues.. Nat Immunol. 2019; 20(8):980-991. (Clone-specific: Flow cytometry). View Reference
  3. Kawabe T, Yi J, Kawajiri A, et al. Requirements for the differentiation of innate T-bethigh memory-phenotype CD4+ T lymphocytes under steady state.. Nat Commun. 2020; 11(1):3366. (Clone-specific: Flow cytometry). View Reference
  4. Li S, Sullivan NL, Rouphael N, et al. Metabolic Phenotypes of Response to Vaccination in Humans.. Cell. 2017; 169(5):862-877.e17. (Clone-specific: Flow cytometry). View Reference
  5. Patel PS, King RG, Kearney JF. Pulmonary α-1,3-Glucan-Specific IgA-Secreting B Cells Suppress the Development of Cockroach Allergy.. J Immunol. 2016; 197(8):3175-3187. (Clone-specific: Flow cytometry). View Reference
  6. Ponzetta A, Carriero R, Carnevale S, et al. Neutrophils Driving Unconventional T Cells Mediate Resistance against Murine Sarcomas and Selected Human Tumors.. Cell. 2019; 178(2):346-360.e24. (Clone-specific: Flow cytometry). View Reference
  7. Reis BS, Rogoz A, Costa-Pinto FA, Taniuchi I, Mucida D. Mutual expression of the transcription factors Runx3 and ThPOK regulates intestinal CD4(+) T cell immunity. Nat Immunol. 2013; 14(3):271-280. (Clone-specific: Flow cytometry). View Reference
  8. Trotta E, Bessette PH, Silveria SL, et al. A human anti-IL-2 antibody that potentiates regulatory T cells by a structure-based mechanism.. Nat Med. 2018; 24(7):1005-1014. (Clone-specific: Flow cytometry). View Reference
View All (8) View Less
940515 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.