Skip to main content Skip to navigation
Oligo Mouse Anti-Mouse Ly-49I

BD™ AbSeq Oligo Mouse Anti-Mouse Ly-49I

Clone YLI-90 (RUO)

25 Tests
Product Details
Down Arrow


BD™ AbSeq
LY49I1; Klra9; killer cell lectin-like receptor subfamily A member 9
16640
2 µl
Mouse BALB/c IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGGCGTAGTGGGCGTTTAGTGATTTAGCAGATGTTC
AMM2191
CHO-K1 cells transfected with the B6 allele of the Ly-49I gene, K1ra9
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940431 Rev. 2
Antibody Details
Down Arrow
YLI-90

The YLI-90 monoclonal antibody specifically reacts with the B6 alloantigen of Ly-49I, an inhibitory receptor which is expressed on subsets of natural killer (NK) cells, NK-1.1+ (or DX5+) T lymphocytes (NK-T cells), and on a population of memory CD8+ T lymphocytes in C57BL/6 mice, but not AKR/J, BALB/c, DBA/1, or SJL mice. The Ly-49 family of NK-cell receptors are disulfide-linked type-II transmembrane protein homodimers with extracellular carbohydrate-recognition domains (CRD). Ly-49I is closely related to Ly-49C[B6] and Ly49C[BALB], and these three alloantigens are recognized by mAb 5E6 (Cat. No. 553277). A Ly-49I[BALB] allele has not been found. The Ly-49 family members are expressed independently, such that an individual NK or T cell may display more than one class of Ly-49 receptor homodimers. Binding of Ly-49I-expressing transfectants to cell lines bearing MHC class I antigens of the b,d, k and s haplotypes was not detected. In contrast, Ly-49I-expressing transfectants were found to weakly bind lymphoblasts of the b, d, k, q, s, and v haplotypes and to strongly bind H-2[r] lymphoblasts. Ly-49I-bearing NK cells may mediate allogeneic and hybrid resistance to transplantation of H-2[d] bone marrow.

940431 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940431 Rev.2
Citations & References
Down Arrow

Development References (8)

  1. Brennan J, Lemieux S, Freeman JD, Mager DL, Takei F. Heterogeneity among Ly-49C natural killer (NK) cells: characterization of highly related receptors with differing functions and expression patterns. J Exp Med. 1996; 184(6):2085-2090. (Biology). View Reference
  2. Coles MC, McMahon CW, Takizawa H, Raulet DH. Memory CD8 T lymphocytes express inhibitory MHC-specific Ly49 receptors. Eur J Immunol. 2000; 30(1):236-244. (Immunogen). View Reference
  3. George T, Yu YY, Liu J, et al. Allorecognition by murine natural killer cells: lysis of T-lymphoblasts and rejection of bone-marrow grafts. Immunol Rev. 1997; 155:29-40. (Biology). View Reference
  4. Hanke T, Takizawa H, McMahon CW, et al. Direct assessment of MHC class I binding by seven Ly49 inhibitory NK cell receptors. Immunity. 1999; 11(1):67-77. (Biology). View Reference
  5. Lian RH, Li Y, Kubota S, Mager DL, Takei F. Recognition of class I MHC by NK receptor Ly-49C: identification of critical residues. J Immunol. 1999; 162(12):7271-7276. (Biology). View Reference
  6. Raulet DH, Held W, Correa I, Dorfman JR, Wu MF, Corral L. Specificity, tolerance and developmental regulation of natural killer cells defined by expression of class I-specific Ly49 receptors. Immunol Rev. 1997; 155:41-52. (Biology). View Reference
  7. Takei F, Brennan J, Mager DL. The Ly-49 family: genes, proteins and recognition of class I MHC. Immunol Rev. 1997; 155:67-77. (Biology). View Reference
  8. The Jackson Laboratory. Mouse Genome Database (MGD), Mouse Genome Informatics Web Site. Available: http://www.informatics.jax.org September, 2003.
View All (8) View Less
940431 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.