Skip to main content Skip to navigation
Oligo Mouse Anti-Human MUC1 (CD227)

BD™ AbSeq Oligo Mouse Anti-Human MUC1 (CD227)

Clone HMPV

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
MUC1; CA 15-3; DF3; EMA; Episialin; H23; H23AG; KL-6; MAM6; PEM; PEMT; PUM
4582
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTGTGTTGACGCGGAATACGGTAAGTGCCAGAAGGT
AHS0270
Human Milk Fat Globule Membranes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940391 Rev. 2
Antibody Details
Down Arrow Up Arrow
HMPV

The HMPV monoclonal antibody specifically binds to CD227 which is also known as Mucin-1 (MUC1).  A major form of CD227 is expressed as a type I transmembrane glycoprotein. CD227 belongs to the epithelial mucin family whose members are heavily O-glycosylated and characterized by high molecular weight, and an amino acid composition rich in serine, threonine, proline, and glycine. CD227 is variably expressed on the surfaces of normal and malignant glandular and ductal epithelial cells, and some hematopoietic cell lineages including subsets of T cells, B cells, monocytes and dendritic cells. Soluble forms of CD227 may arise by shedding from the cell surface or by secretion of forms derived from alternative RNA splicing. The HMPV antibody binds to the core peptide of the MUC1 protein. The core protein contains a domain of 20 amino-acid tandem repeats which function as multiple epitopes for this monoclonal antibody. Incomplete glycosylation of some tumor-associated mucins may lead to variable unmasking of the multiple peptide epitopes leading to the observed differences in immunostaining intensities between cells from normal and malignant tissues. CD227 plays roles in the provision of protective barrier function, the regulation of cellular adhesion, and the transduction of multiple signal pathways.

940391 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940391 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (6)

  1. Agrawal B, Krantz MJ, Parker J, Longenecker BM. Expression of MUC1 mucin on activated human T cells: implications for a role of MUC1 in normal immune regulation. Cancer Res. 1998; 58(18):4079-4081. (Biology: ELISA, Flow cytometry). View Reference
  2. Devine PL, Birrell GW, Whitehead RH, Harada H, Xing PX, McKenzie IF. Expression of MUC1 and MUC2 mucins by human tumor cell lines. Tumour Biol. 1992; 13(5):268-277. (Biology). View Reference
  3. McGuckin MA, MacDonald KP, Tran M, Wykes M, Hart DNJ. MUC1 Epithelial mucin: expression by normal hematopoietic cells. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:496-499.
  4. McGuckin MA. CD227 (MUC1) Summary and Workshop Report. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:494-496.
  5. Xing PX, Prenzoska J, McKenzie IF. Epitope mapping of anti-breast and anti-ovarian mucin monoclonal antibodies. Mol Immunol. 1992; 29(5):641-650. (Clone-specific: Blocking, ELISA). View Reference
  6. Xing PX, Prenzoska J, Quelch K, McKenzie IF. Second generation anti-MUC1 peptide monoclonal antibodies. Cancer Res. 1992; 52(8):2310-2317. (Immunogen: Blocking, Radioimmunoassay). View Reference
View All (6) View Less
940391 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.