Skip to main content Skip to navigation
Oligo Mouse Anti-Mouse CD22.2

BD™ AbSeq Oligo Mouse Anti-Mouse CD22.2

Clone Cy34.1

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Lyb8.2; Lyb-8.2; BL-CAM; Siglec-2
12483
2 µl
Mouse DBA/1 IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CATGGTTGTTTGAGCGCGAATTGTAGTTGAAGGTTG
AMM2252
B10.D2 mouse splenocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. Please refer to bd.com/genomics-resources for technical protocols.
  6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940505 Rev. 2
Antibody Details
Down Arrow Up Arrow
Cy34.1

The Cy34.1 monoclonal antibody specifically binds to the B-lymphocyte differentiation antigen CD22 on strains having the Lyb-8.2 alloantigen (e.g., A, BALB/c, CBA, C3H/He, C57BL, C57L, C58, SJL, SWR, but not AKR, DBA/1, DBA/2, NZB, PL). CD22 is expressed at high levels on mature peripheral B lymphocytes (follicular  and marginal zone), B-1 cells (CD5+ B cells), and plasma cells.  It is a member of the Ig gene superfamily and associates with the B-cell antigen receptor. Its sialic acid- binding immunoglobulin-like lectin (siglec) extracellular region mediates B-cell adhesion to ligands on endothelial cells in the bone marrow.  Its intracellular  domain is phosphorylated after cross-linking of antigen receptor  or MHC class II antigen.  It is involved in negative regulation of B-cell activation and protection from autoimmunity.  B-cell proliferative responses to LPS or anti-mouse Ig µ chain are augmented in the presence of Cy34.1 mAb.

940505 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940505 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (11)

  1. Bobbitt KR, Justement LB. Regulation of MHC class II signal transduction by the B cell coreceptors CD19 and CD22. J Immunol. 2000; 165(10):5588-5596. (Biology). View Reference
  2. Doody GM, Justement LB, Delibrias CC. A role in B cell activation for CD22 and the protein tyrosine phosphatase SHP. Science. 1995; 269(5221):242-244. (Biology). View Reference
  3. Erickson LD, Tygrett LT, Bhatia SK, Grabstein KH, Waldschmidt TJ. Differential expression of CD22 (Lyb8) on murine B cells. Int Immunol. 1996; 8(7):1121-1129. (Biology). View Reference
  4. Law CL, Sidorenko SP, Clark EA. Regulation of lymphocyte activation by the cell-surface molecule CD22. Immunol Today. 1994; 15(9):442-449. (Biology). View Reference
  5. Law CL, Torres RM, Sundberg HA. Organization of the murine Cd22 locus. Mapping to chromosome 7 and characterization of two alleles. J Immunol. 1993; 151(1):175-187. (Clone-specific). View Reference
  6. Mary C, Laporte C, Parzy D. Dysregulated expression of the Cd22 gene as a result of a short interspersed nucleotide element insertion in Cd22a lupus-prone mice. J Immunol. 2000; 165(6):2987-2996. (Biology). View Reference
  7. Nitschke L, Floyd H, Ferguson DJ, Crocker PR. Identification of CD22 ligands on bone marrow sinusoidal endothelium implicated in CD22-dependent homing of recirculating B cells. J Exp Med. 1999; 189(9):1513-1518. (Biology). View Reference
  8. O'Keefe TL, Williams GT, Davies SL, Neuberger MS. Hyperresponsive B cells in CD22-deficient mice. Science. 1996; 274(5288):798-801. (Biology). View Reference
  9. Stall AM, Wells SM. FACS analysis of murine B-cell populations. In: Herzenberg LA, Weir DM, Blackwell C, ed. Weir's Handbook of Experimental Immunology. Blackwell Science Publishers; 1997:63.1-63.17.
  10. Stoddart A, Ray RJ, Paige CJ. Analysis of murine CD22 during B cell development: CD22 is expressed on B cell progenitors prior to IgM. Int Immunol. 1997; 9(10):1571-1579. (Biology). View Reference
  11. Symington FW, Subbarao B, Mosier DE, Sprent J. Lyb-8.2: A new B cell antigen defined and characterized with a monoclonal antibody. Immunogenetics. 1982; 16(5):381-391. (Immunogen: Immunoprecipitation). View Reference
View All (11) View Less
940505 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.