Skip to main content Skip to navigation
Oligo Rat Anti-Mouse Vβ 11 T-Cell Receptor

BD™ AbSeq Oligo Rat Anti-Mouse Vβ 11 T-Cell Receptor

Clone RR3-15

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
TCR V beta 11
100124680
2 µl
Rat F344, also known as Fischer, CDF IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TATGGTCTTACTGAGGGCGGAATTAGGTTGTTGGGC
AMM2190
Mouse Cytolytic T-Cell Clone OH6
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940430 Rev. 2
Antibody Details
Down Arrow Up Arrow
RR3-15

The RR3-15 antibody reacts with the Vβ 11 T-Cell Receptor (TCR) of mice having the b haplotype (e.g., A, C57BL, C58, DBA/1) of the Tcrb gene complex. The Tcrb-V11 gene locus is deleted in mice having the a (e.g., C57BR, C57L, SJL, SWR) and c (e.g., RIII) haplotypes. Vβ TCR-bearing T lymphocytes are clonally eliminated in mice expressing I-E and superantigens encoded by Mtv-9 (Etc-1, Mls[f], Dvb11.2) and/or Mtv-11 (Mls[f], Dvb 11.2) proviruses (e.g., AKR, BALB/c, CBA/J, C3H, DBA/2), and they are incompletely eliminated in mice expressing I-E and Mtv-8 (Mls[f], Dvb 11.1) superantigen (e.g., A). Activation of Vβ 11 TCR-expressing T cells by these determinants is dependent upon presentation by I-E. The bacterial superantigen Staphylococcal enterotoxin A (SEA) also interacts with Vβ 11 TCR, and in vivo exposure to SEA causes activation and subsequent deletion of Vβ TCR-expressing lymphocytes. Plate-bound RR3-15 antibody activates Vβ 11 TCR-bearing T cells.

940430 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940430 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (8)

  1. Behlke MA, Chou HS, Huppi K, Loh DY. Murine T-cell receptor mutants with deletions of beta-chain variable region genes. Proc Natl Acad Sci U S A. 1986; 83(3):767-771. (Biology). View Reference
  2. Bill J, Kanagawa O, Woodland DL, Palmer E. The MHC molecule I-E is necessary but not sufficient for the clonal deletion of V beta 11-bearing T cells. J Exp Med. 1989; 169(4):1405-1419. (Immunogen). View Reference
  3. Gao EK, Kanagawa O, Sprent J. Capacity of unprimed CD4+ and CD8+ T cells expressing V beta 11 receptors to respond to I-E alloantigens in vivo. J Exp Med. 1989; 170(6):1947-1957. (Biology). View Reference
  4. Haqqi TM, Banerjee S, Anderson GD, David CS. RIII S/J (H-2r). An inbred mouse strain with a massive deletion of T cell receptor V beta genes. J Exp Med. 1989; 169(6):1903-1909. (Biology). View Reference
  5. Hodes RJ, Abe R. Mouse endogenous superantigens: Ms and Mls-like determinants encoded by mouse retroviruses.. Curr Protoc Immunol. 2001; Appendix 1:Appendix 1F. (Biology). View Reference
  6. Kruisbeek AM, Shevach EM. Proliferative assays for T cell function. Curr Protoc Immunol. 2004; 3:3.12.1-3.12.14. (Biology). View Reference
  7. McCormack JE, Callahan JE, Kappler J, Marrack PC. Profound deletion of mature T cells in vivo by chronic exposure to exogenous superantigen. J Immunol. 1993; 150(9):3785-3792. (Biology). View Reference
  8. Sugihara S, Fujiwara H, Shearer GM. Autoimmune thyroiditis induced in mice depleted of particular T cell subsets. Characterization of thyroiditis-inducing T cell lines and clones derived from thyroid lesions. J Immunol. 1993; 150(2):683-694. (Biology). View Reference
View All (8) View Less
940430 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.