Skip to main content Skip to navigation
Oligo Rat Anti-Mouse TIM-2

BD™ AbSeq Oligo Rat Anti-Mouse TIM-2

Clone RMT2-26 (RUO)

940426
EA (1 Each)
25 Tests
Add Product To QuoteAdd to Quote
Product Details
Down Arrow


BD™ AbSeq
T-cell membrane protein 2; Tim-2; Tim2; TIMD-2; Timd2
171284
2 µl
Rat SD, also known as Sprague-Dawley (outbred) IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGTGGTGATGAGCGCAAGGGTGTTATTCGATGTGTC
AMM2184
Mouse TIM-2 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940426 Rev. 2
Antibody Details
Down Arrow
RMT2-26

The RMT2-26 monoclonal antibody specifically recognizes T cell immunoglobulin and mucin domain-2 (TIM-2) which is also known as T-cell membrane protein 2, TIMD-2, or Tim2. TIM-2 is an ~55 kDa type I transmembrane glycoprotein that is encoded by Timd2 (T cell immunoglobulin and mucin domain containing 2) which belongs to the immunoglobulin gene superfamily. TIM-2 contains extracellular IgV and mucin domains and a cytoplasmic region with a conserved tyrosine phosphorylation motif which is involved in transmembrane signaling. A human ortholog for mouse TIM-2 has not been identified. TIM-2 is reportedly expressed on B cells with higher levels on activated B cells and germinal center B cells, type-2 T helper (Th2) cells, oligodendrocytes, and epithelial cells in the kidney and liver. It may serve as a receptor for Semaphorin 4A (Sema4A) or the heavy chain of ferritin (H-ferritin). The RMT2-26 antibody can reportedly block the binding of H-ferritin to TIM-2.

940426 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940426 Rev.2
Citations & References
Down Arrow

Development References (8)

  1. Abe Y, Kamachi F, Kawamoto T, et al. TIM-4 has dual function in the induction and effector phases of murine arthritis.. J Immunol. 2013; 191(9):4562-72. (Clone-specific: Flow cytometry). View Reference
  2. Chakravarti S, Sabatos CA, Xiao S, et al. Tim-2 regulates T helper type 2 responses and autoimmunity.. J Exp Med. 2005; 202(3):437-44. (Biology). View Reference
  3. Chen TT, Li L, Chung DH, et al. TIM-2 is expressed on B cells and in liver and kidney and is a receptor for H-ferritin endocytosis.. J Exp Med. 2005; 202(7):955-65. (Biology). View Reference
  4. Han J, Seaman WE, Di X, et al. Iron uptake mediated by binding of H-ferritin to the TIM-2 receptor in mouse cells.. PLoS ONE. 2011; 6(8):e23800. (Biology). View Reference
  5. Kawamoto T, Abe Y, Ito J, et al. Anti-T cell immunoglobulin and mucin domain-2 monoclonal antibody exacerbates collagen-induced arthritis by stimulating B cells.. Arthritis Res Ther. 2011; 13(2):R47. (Immunogen: Blocking, Flow cytometry, Immunoprecipitation, Western blot). View Reference
  6. Kumanogoh A, Marukawa S, Suzuki K, et al.. Class IV semaphorin Sema4A enhances T-cell activation and interacts with Tim-2. Nature. 2002; 419(6907):629-633. (Biology). View Reference
  7. Rennert PD, Ichimura T, Sizing ID, et al. T cell, Ig domain, mucin domain-2 gene-deficient mice reveal a novel mechanism for the regulation of Th2 immune responses and airway inflammation.. J Immunol. 2006; 177(7):4311-21. (Biology). View Reference
  8. Rodriguez-Manzanet R, DeKruyff R, Kuchroo VK, Umetsu DT. The costimulatory role of TIM molecules. Immunol Rev. 2009; 229(1):259-270. (Biology). View Reference
View All (8) View Less
940426 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.