Skip to main content Skip to navigation
Oligo Rat Anti-Mouse Delta-Like Protein 4

BD™ AbSeq Oligo Rat Anti-Mouse Delta-Like Protein 4

Clone 9A1.5 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Delta like-4; Delta4; Dll4; DL4; DL-4
54485
2 µl
Rat LOU, also known as Louvain, LOU/C, LOU/M IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGATAGAGGTGTAGTGAATAATGGATAGTCGGCAGT
AMM2262
Mouse DL4 Extracellular Domain Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. Please refer to bd.com/genomics-resources for technical protocols.
  6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940493 Rev. 2
Antibody Details
Down Arrow Up Arrow
9A1.5

The 9A1.5 monoclonal antibody specifically binds to an extracellular domain of Delta-Like Protein 4 that is encoded by the Dll4 gene. Delta-Like Protein 4 is a type 1 transmembrane glycoprotein that is also known as Delta-like 4, Delta-like Ligand 4, Delta4 and DL4. It is a member of the Delta/Serrate/Jagged Family of Notch ligands. Notch ligands are classified by the presence of specific structural motifs including an N-terminal Delta-Serrate-LAG-2 (DSL) domain necessary for Notch binding, EGF repeats, and the DOS domain (a specialized EGF repeat). The Notch family of transmembrane receptors and their ligands control cell-fate "decisions" during the development of many organs in a wide variety of animal species. Delta-Like Protein 4 activates cellular signaling pathways by binding to Notch1 and Notch4 receptors. It is involved in embryonic vascular development and tumor angiogenesis, and is induced by vascular endothelial growth factor (VEGF)-A and hypoxia. Delta-Like Protein 4 and Notch receptor signaling are also intimately involved in the regulation of innate and adaptive immunity. Delta-Like Protein 4 is highly expressed by cortical thymic epithelial cells (TEC). Interaction between Delta-Like Protein 4-positive TEC and Notch1 expressed by T cell precursors drives T cell lineage commitment, expansion and maturation within the thymus. Delta-Like Protein 4 is also expressed by dendritic cells and plays a role in peripheral T helper cell differentiation. Blocking of Delta-Like Protein 4 and Notch receptor interactions serves to diminish autoimmune diseases in mouse model systems.

940493 Rev. 2
Format Details
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940493 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940493" on CiteAb

Development References (7)

  1. Fiorini E, Ferrero I, Merck E, et al. Cutting edge: thymic crosstalk regulates delta-like 4 expression on cortical epithelial cells. J Immunol. 2008; 181(12):8199-8203. (Immunogen: ELISA, Fluorescence microscopy, Immunofluorescence). View Reference
  2. Kassner N, Krueger M, Yagita H, et al. Cutting edge: Plasmacytoid dendritic cells induce IL-10 production in T cells via the Delta-like-4/Notch axis. J Immunol. 2010; 184(2):550-554. (Biology). View Reference
  3. Koch U, Fiorini E, Benedito R, et al. Delta-like 4 is the essential, nonredundant ligand for Notch1 during thymic T cell lineage commitment. J Exp Med. 2008; 205(11):2515-2523. (Clone-specific: Flow cytometry). View Reference
  4. Mori M, Yoneyama M, Ito T, Takahashi K, Inagaki F, Fujita T. Identification of Ser-386 of interferon regulatory factor 3 as critical target for inducible phosphorylation that determines activation. J Biol Chem. 2004; 279(11):9698-9702. (Biology). View Reference
  5. Radtke F, MacDonald HR, Tacchini-Cottier F. Regulation of innate and adaptive immunity by Notch. Nat Rev Immunol. 2013; 13(6):427-437. (Biology). View Reference
  6. Shutter JR, Scully S, Fan W, et al. Dll4, a novel Notch ligand expressed in arterial endothelium. Genes Dev. 2000; 14:1313-1318. (Biology). View Reference
  7. Shutter JR, Scully S, Fan W, et al. Molecular cloning of delta-4, a new mouse and human Notch ligand. J Biochem (Tokyo). 2001; 129(1):27-34. (Biology). View Reference
View All (7) View Less
940493 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.