Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD45

BD™ AbSeq Oligo Rat Anti-Mouse CD45

Clone 30-F11 (RUO)

567861
EA (1 Each)
25 Tests
Add Product To QuoteAdd to Quote
Product Details
Down Arrow


BD™ AbSeq
Ptprc; LCA; Leukocyte common antigen; T200; Ly-5; Lyt-4
19264
2 µl
Rat LOU, also known as Louvain, LOU/C, LOU/M IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GCGATTGCTTAGTTACGTGGTTCATTAGGCGGGATT
AMM2004
Mouse Thymus / Spleen
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940320 Rev. 2
Antibody Details
Down Arrow
30-F11

The 30-F11 clone has been reported to react with all isoforms and both alloantigens of CD45, which is found on hematopoietic stem cells and all cells of hematopoietic origin, except erythrocytes. CD45 is a transmembrane glycoprotein which is expressed at high levels on the cell surface, and its presence distinguishes leukocytes from non-hematopoietic cells. CD45 is a member of the Protein Tyrosine Phosphatase (PTP) family, where the intracellular carboxy-terminal region contains two PTP catalytic domains, and the extracellular region is highly variable due to alternative splicing of exons 4, 5, and 6 (designated as A, B, and C, respectively).  CD45 isoforms play complex roles in T-cell and B-cell antigen receptor signal transduction and the CD45 isoforms detected in the mouse are cell type-, maturation-, and activation state-specific.

940320 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940320 Rev.2
Citations & References
Down Arrow

Development References (5)

  1. Johnson P, Maiti A, Ng DHW. CD45: A family of leukocyte-specific cell surface glycoproteins. In: Herzenberg LA, Weir DM, Herzenberg LA, Blackwell C , ed. Weir's Handbook of Experimental Immunology, Vol 2. Cambridge: Blackwell Science; 1997:62.1-62.16.
  2. Lagasse E, Connors H, Al-Dhalimy M, et al. Purified hematopoietic stem cells can differentiate into hepatocytes in vivo. Nat Med. 2000; 6(11):1212-1213. (Biology). View Reference
  3. Ledbetter JA, Herzenberg LA. Xenogeneic monoclonal antibodies to mouse lymphoid differentiation antigens. Immunol Rev. 1979; 47:63-90. (Immunogen: Cytotoxicity, Immunoprecipitation). View Reference
  4. Simon DI, Dhen Z, Seifert P, Edelman ER, Ballantyne CM, Rogers C. Decreased neointimal formation in Mac-1(-/-) mice reveals a role for inflammation in vascular repair after angioplasty. J Clin Pathol. 2000; 105(3):293-300. (Clone-specific: Immunohistochemistry). View Reference
  5. Thomas ML. The leukocyte common antigen family. Annu Rev Immunol. 1989; 7:339-369. (Clone-specific: Immunohistochemistry). View Reference
940320 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.