Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD180

BD™ AbSeq Oligo Rat Anti-Mouse CD180

Clone RP/14 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Ly78; Ly-78; Lymphocyte antigen 78; RP105; Radioprotective 105 kDa protein
17079
2 µl
Rat WI, also known as Wistar (outbred) IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGAGCGACGGTAATGGCATGATAAGGTGATAGACGG
AMM2259
BALB/c mouse splenocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940459 Rev. 2
Antibody Details
Down Arrow Up Arrow
RP/14

The RP/14 monoclonal antibody specifically binds to CD180, the "radioprotective" 105 kDa (RP105) antigen expressed on mature B lymphocytes. Like other members of the Toll-like Receptor (TLR) family, the extracellular region of CD180 contains tandem repeats of a leucine-rich motif flanked by regions containing conserved cysteines. These characteristic structural components of TLR may mediate protein-protein interactions and regulation of signal transduction involved in innate immune responses. Furthermore, CD180 associates with the secretory protein MD-1 on the cell surface. Cross-linking of cell-surface CD180 with the RP/14 antibody induces activation signals in B lymphocytes. Despite the expression of CD180 on lymphocytes of all strains tested (BALB/c, BALB/c.xid, C3H, C57BL/6, CBA/N, and 129/Sv), some strains (BALB/c.xid, C57BL/6.xid, CBA/N, 129/Sv, and 129/Ola) display deficient responses to that stimulatory effects of mAb RP/14.

940459 Rev. 2
Format Details
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940459 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940459" on CiteAb

Development References (7)

  1. Chan VW, Mecklenbrauker I, Su I, et al. The molecular mechanism of B cell activation by toll-like receptor protein RP-105. J Exp Med. 1998; 188(1):93-101. (Clone-specific: Activation). View Reference
  2. Corcoran LM, Metcalf D. IL-5 and Rp105 signaling defects in B cells from commonly used 129 mouse substrains. J Immunol. 1999; 163(11):5836-5842. (Clone-specific: Activation). View Reference
  3. Miyake K, Shimazu R, Kondo J, et al. Mouse MD-1, a molecule that is physically associated with RP105 and positively regulates its expression.. J Immunol. 1998; 161(3):1348-1353. (Clone-specific: Immunoprecipitation). View Reference
  4. Miyake K, Yamashita Y, Hitoshi Y, Takatsu K, Kimoto M. Murine B cell proliferation and protection from apoptosis with an antibody against a 105-kD molecule: unresponsiveness of X-linked immunodeficient B cells. J Exp Med. 1994; 180(4):1217-1224. (Immunogen: Activation, Apoptosis, Immunoprecipitation). View Reference
  5. Miyake K, Yamashita Y, Ogata M, Sudo T, Kimoto M. RP105, a novel B cell surface molecule implicated in B cell activation, is a member of the leucine-rich repeat protein family. J Immunol. 1995; 154(7):3333-3340. (Clone-specific: Immunoprecipitation). View Reference
  6. Ogata H, Su I, Miyake K, et al. The toll-like receptor protein RP105 regulates lipopolysaccharide signaling in B cells. J Exp Med. 2000; 192(1):23-29. (Biology). View Reference
  7. Yamashita Y, Miyake K, Miura Y, et al. Activation mediated by RP105 but not CD40 makes normal B cells susceptible to anti-IgM-induced apoptosis: a role for Fc receptor coligation. J Exp Med. 1996; 184(1):113-120. (Clone-specific: Activation). View Reference
View All (7) View Less
940459 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.