Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD104

BD™ AbSeq Oligo Rat Anti-Mouse CD104

Clone 346-11A

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
β4 integrin; Integrin β4 chain; Integrin beta-4; Itgb4; ITB4
192897
2 µl
Rat F344, also known as Fischer, CDF IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTTTGGATATTAGAAGGTCGAGGCGTCAGAAGATGG
AMM2183
Tumor-associated antigen TSP-180 from a BALB/c mouse lung carcinoma
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. Please refer to bd.com/genomics-resources for technical protocols.
  6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940501 Rev. 2
Antibody Details
Down Arrow Up Arrow
346-11A

The 346-11A monoclonal antibody specifically recognizes an epitope at the beginning of the cysteine-rich repeat region of the 200-kDa integrin β4 chain (CD104), which is found on the cell surface as a heterodimeric complex with the integrin α6 chain (CD49f). The α6β4 (CD49f/CD104) complex binds to laminins and is expressed on the basal surface of a variety of epithelial cell types, particularly on stratified squamous epithelia, and is also found in peripheral nerves, in certain subsets of endothelial cells, and on immature thymocytes. It has also been identified on a number of tumor tissues and participates in tumor progression events. Localization of both human and mouse epidermal α6β4 integrin to hemidesmosomes suggests that this heterodimer plays a role in epidermal adhesion to the basement membrane.

940501 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940501 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940501" on CiteAb

Development References (8)

  1. Giancotti FG. Signal transduction by the alpha 6 beta 4 integrin: charting the path between laminin binding and nuclear ev. J Cell Sci. 1996; 109(6):1165-1172. (Biology). View Reference
  2. Kennel SJ, Foote LJ, Falcioni R, et al. Analysis of the tumor-associated antigen TSP-180. Identity with alpha 6-beta 4 in the integrin superfamily. J Biol Chem. 1989; 264(26):15515-15521. (Clone-specific: Immunoprecipitation, Western blot). View Reference
  3. Kennel SJ, Foote LJ, Flynn KM. Tumor antigen on benign adenomas and on murine lung carcinomas quantitated by a two-site monoclonal antibody assay. Cancer Res. 1986; 46(2):707-712. (Immunogen: Blocking, Immunoprecipitation, Radioimmunoassay). View Reference
  4. Morena A, Riccioni S, Marchetti A, et al. Expression of the beta 4 integrin subunit induces monocytic differentiation of 32D/v-Abl cells. Blood. 2002; 100(1):96-106. (Biology). View Reference
  5. Salmivirta K, Gullberg D, Hirsch E, Altruda F, Ekblom P. Integrin subunit expression associated with epithelial-mesenchymal interactions during murine tooth development. Dev Dyn. 1996; 205(2):104-113. (Clone-specific: Immunohistochemistry). View Reference
  6. Sonnenberg A, Calafat J, Janssen H, et al. Integrin alpha 6/beta 4 complex is located in hemidesmosomes, suggesting a major role in epidermal cell-basement membrane adhesion.. J Cell Biol. 1991; 113(4):907-17. (Clone-specific: Immunohistochemistry). View Reference
  7. Sonnenberg A, Linders CJ, Daams JH, Kennel SJ. The alpha 6 beta 1 (VLA-6) and alpha 6 beta 4 protein complexes: tissue distribution and biochemical properties. J Cell Sci. 1990; 96(2):207-217. (Clone-specific: Immunohistochemistry, Immunoprecipitation, Western blot). View Reference
  8. van der Neut R, Krimpenfort P, Calafat J, Niessen CM, Sonnenberg A. Epithelial detachment due to absence of hemidesmosomes in integrin beta 4 null mice. Nat Genet. 1996; 13(3):366-369. (Biology). View Reference
View All (8) View Less
940501 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.