Skip to main content Skip to navigation
Oligo Mouse Anti-Human FcεR1α

BD™ AbSeq Oligo Mouse Anti-Human FcεR1α

Clone AER-37 (also known as CRA-1, CRA1) (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
FCE1A; FCER1A; Fc-epsilon RI-alpha; FcERI; FceR1a; FcεRI
2205
2 µl
Mouse IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GATATGGCGTGATGGTAGGTTCGGTTTAAGTTAGCG
AHS0129
Recombinant Extracellular Domain of FcεR1α
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940220 Rev. 2
Antibody Details
Down Arrow Up Arrow
AER-37

The AER-37 (CRA-1) monoclonal antibody specifically recognizes FcεRIα which is also known as the high affinity immunoglobulin epsilon receptor subunit alpha (Fc-epsilon RI-alpha). FcεRIα is a type I transmembrane glycoprotein that is encoded by FCER1A (Fc fragment of IgE receptor Ia) which belongs to the Ig gene superfamily. FcεRIα serves as the binding subunit for the Fc region of IgE. It forms part of a heterotetrameric, high-affinity IgE Fc receptor (FceR1/FcεR1) that includes signal transducing subunits, one β-chain (FcεRIβ encoded by MS4A2) and two disulfide-linked γ-subunits (FcεRIγ encoded by FCER1G).  FcεRIα is normally expressed on basophils and mast cells and can also be expressed on some monocytes, Langerhans cells, dendritic cells, and eosinophils from allergic donors. FcεRIα plays a major role in allergic responses and in the presentation of allergens to the immune system. The AER-37 antibody reportedly does not compete with IgE for FceR1 binding.

940220 Rev. 2
Format Details
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940220 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940220" on CiteAb

Development References (6)

  1. Cheng YX, Foster B, Holland SM, et al. CD2 identifies a monocyte subpopulation with immunoglobulin E-dependent, high-level expression of Fc epsilon RI.. Clin Exp Allergy. 2006; 36(11):1436-45. (Clone-specific: Flow cytometry). View Reference
  2. Foster B, Metcalfe DD, Prussin C. Human dendritic cell 1 and dendritic cell 2 subsets express FcepsilonRI: correlation with serum IgE and allergic asthma.. J Allergy Clin Immunol. 2003; 112(6):1132-8. (Clone-specific: Flow cytometry). View Reference
  3. Gounni AS, Lamkhioued B, Ochiai K, et al. High-affinity IgE receptor on eosinophils is involved in defence against parasites. Nature. 1994; 367(6459):183-186. (Biology). View Reference
  4. Jürgens M, Wollenberg A, Hanau D, de la Salle H, Bieber T. Activation of human epidermal Langerhans cells by engagement of the high affinity receptor for IgE, Fc epsilon RI.. J Immunol. 1995; 155(11):5184-9. (Biology). View Reference
  5. Maurer D, Fiebiger S, Ebner C, et al. Peripheral blood dendritic cells express Fc epsilon RI as a complex composed of Fc epsilon RI alpha- and Fc epsilon RI gamma-chains and can use this receptor for IgE-mediated allergen presentation.. J Immunol. 1996; 157(2):607-16. (Biology). View Reference
  6. Takai T, Yuuki T, Iwamoto-Yasue N, Okumura K, Ra C. Epitope analysis and primary structures of variable regions of anti-human FcepsilonRI monoclonal antibodies, and expression of the chimeric antibodies fused with human constant regions.. Biosci Biotechnol Biochem. 2000; 64(9):1856-67. (Immunogen: Flow cytometry, Western blot). View Reference
View All (6) View Less
940220 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.