Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD64

BD™ AbSeq Oligo Mouse Anti-Human CD64

Clone 10.1 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
FCGR1; FcRI; Fc-gamma RI; IgG Fc Receptor I; High affinity IgG FcR1
2209
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTGTGCGGCGTAGTATGGTTATCTCGAGTGAAAGTC
AHS0055
Human Rheumatoid synovial fluid cells and fibronectin-purified monocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940023 Rev. 3
Antibody Details
Down Arrow Up Arrow
10.1

The 10.1 monoclonal antibody specifically binds to CD64, a 72 kDa type I transmembrane glycoprotein that is a high affinity receptor for human IgG (FcγRI), especially the IgG1 and IgG3 subclasses. CD64 is expressed on monocytes, macrophages, dendritic cells, granulocytes activated with interferon-gamma and early myeloid lineage cells. CD64 associates with a signaling FcRγ homodimer to form the functional high affinity FcγRI complex. CD64 functions in both innate and adaptive immune responses and mediates endocytosis, phagocytosis, antigen presentation, antibody-dependent cellular toxicity, cytokine release and superoxide generation.

940023 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940023 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940023" on CiteAb

Development References (5)

  1. CD64. In: Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007:151.
  2. Dougherty GJ, Selvendran Y, Murdoch S, Palmer DG, Hogg N. The human mononuclear phagocyte high-affinity Fc receptor, FcRI, defined by a monoclonal antibody, 10.1. Eur J Immunol. 1987; 17(10):1453-1459. (Immunogen: Blocking, Flow cytometry, Inhibition). View Reference
  3. Indik ZK, Hunter S, Huang MM, et al. The high affinity Fc gamma receptor (CD64) induces phagocytosis in the absence of its cytoplasmic domain: the gamma subunit of Fc gamma RIIIA imparts phagocytic function to Fc gamma RI. Exp Hematol. 1994; 22(7):599-606. (Biology). View Reference
  4. Sun W, O'Shea JJ, Guyre PM. CD64 Workshop Panel Report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:988-990.
  5. van Vugt MJ, Heijnen AF, Capel PJ, et al. FcR gamma-chain is essential for both surface expression and function of human Fc gamma RI (CD64) in vivo. Blood. 1996; 87(9):3593-3599. (Biology). View Reference
940023 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.