Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD33

BD™ AbSeq Oligo Mouse Anti-Human CD33

Clone P67.6 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Siglec-3; SIGLEC3; Sialic acid-binding Ig-like lectin 3; p67; gp67; My9
945
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTCTGGGCGTTGGTAGTATTAGCGATGTATGGCGGT
AHS0171
CD33-transfected FMY9S5 Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940255 Rev. 2
Antibody Details
Down Arrow Up Arrow
P67.6

The monoclonal antibody specifically recognizes CD33, a human myelomonocytic antigen which is also known as Sialic acid-binding Ig-like lectin 3 (Siglec-3 or SIGLEC3). CD33 is a 67 kDa type I transmembrane glycoprotein that belongs to the Ig supergene family. The CD33 antigen is present on monocytes (bright) and granulocytes (dim). Granulocytes can be further subdivided into neutrophil, eosinophil, and basophil populations based on CD33 staining in combination with other cell-surface antigens. The CD33 antigen is also found on CFU-Mix, CFU-GM, CFU-Meg, a portion of BFU-E, myeloblasts, promyelocytes, myelocytes, and metamyelocytes, but not on earlier precursors. The CD33 antigen is expressed on blast cells in greater than 85% of acute myeloid leukemias (AML), and it can be aberrantly expressed in acute lymphoblastic leukemias (ALL). Normal lymphocytes, platelets, and erythrocytes do not express the CD33 antigen. CD33 can reportedly function as a sialic acid-dependent cell adhesion molecule and this function can be modulated by endogenous sialoglycoconjugates when CD33 is expressed on the membrane.

940255 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940255 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940255" on CiteAb

Development References (6)

  1. Andrews RG, Torok-Storb B, Bernstein ID. Myeloid-associated differentiation antigens on stem cells and their progeny identified by monoclonal antibodies.. Blood. 1983; 62(1):124-32. (Biology). View Reference
  2. Bernstein ID, Singer JW, Andrews RG, et al. Treatment of acute myeloid leukemia cells in vitro with a monoclonal antibody recognizing a myeloid differentiation antigen allows normal progenitor cells to be expressed.. J Clin Invest. 1987; 79(4):1153-9. (Biology). View Reference
  3. Dinndorf PA, Andrews RG, Benjamin D, Ridgway D, Wolff L, Bernstein ID. Expression of normal myeloid-associated antigens by acute leukemia cells.. Blood. 1986; 67(4):1048-53. (Biology). View Reference
  4. Foon KA, Todd RF. Immunologic classification of leukemia and lymphoma.. Blood. 1986; 68(1):1-31. (Biology). View Reference
  5. Köller U, Peschel CH. Cluster report: CD33. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:812-813.
  6. Terstappen LW, Hollander Z, Meiners H, Loken MR. Quantitative comparison of myeloid antigens on five lineages of mature peripheral blood cells. J Leukoc Biol. 1990; 48(2):138-148. (Biology). View Reference
View All (6) View Less
940255 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.