Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD22

BD™ AbSeq Oligo Mouse Anti-Human CD22

Clone HIB22 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
BL-CAM; Siglec-2; Bgp135; Lyb8; LPAP
933
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGGTTCGTGACTGTATAGGCTTAGCTTAGGCAATTT
AHS0195
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940273 Rev. 2
Antibody Details
Down Arrow Up Arrow
HIB22

The HIB22 monoclonal antibody specifically binds to CD22. CD22 is a 130-140 kDa glycosylated type I integral membrane protein present on the surface of mature B cells. CD22 is expressed in the cytoplasm of virtually all B cells except plasma cells. CD45RO antigen on T cells and CD75 antigen on B cells have been identified as ligands for CD22. CD22 has been reported to participate in B-cell activation and also as an adhesion molecule. Although the immunobiology of this antigen has not been fully elucidated, reports indicate that ligation of CD22 induces constitutive internalization of the molecule followed by complete degradation.

940273 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940273 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940273" on CiteAb

Development References (5)

  1. Clark EA. CD22, a B cell-specific receptor, mediates adhesion and signal transduction. J Immunol. 1993; 150(11):4715-4718. (Biology). View Reference
  2. Kehrl JH. CD22 Workshop Panel report. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:523-525.
  3. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  4. Shan D, Press OW. Constitutive endocytosis and degradation of CD22 by human B cells. J Immunol. 1995; 154(9):4466-4475. (Biology). View Reference
  5. Stamenkovic I, Sgroi D, Aruffo A, Sy MS, Anderson T. The B lymphocyte adhesion molecule CD22 interacts with leukocyte common antigen CD45RO on T cells and alpha 2-6 sialyltransferase, CD75, on B cells. Cell. 1991; 66(6):1133-1144. (Biology). View Reference
940273 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.