Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD15

BD™ AbSeq Oligo Mouse Anti-Human CD15

Clone W6D3 (RUO)

571239
EA (1 Each)
25 Tests
Add Product To QuoteAdd to Quote
Product Details
Down Arrow


BD™ AbSeq
3-fucosyl-N-acetyllactosamine; 3-FAL
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATAGGCATGGACGACGTAGATAATAAGTGGCGGGTT
AHS0196
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940274 Rev. 2
Antibody Details
Down Arrow
W6D3

The W6D3 monoclonal antibody specifically binds to 3-fucosyl-N-acetyllactosamine (3-FAL), a 220 kDa carbohydrate structure, also called X-hapten. 3-FAL is expressed on >95% of granulocytes, including neutrophils and eosinophils, and on monocytes to a varying degree, but not on lymphocytes or basophils. CD15 plays a role in mediating phagocytosis, bactericidal activity and chemotaxis. Most CD15 antibodies are IgM isotype; clone W6D3 is a mouse IgG1 isotype. In comparison studies with clone HI98, a known CD15 antibody, clone W6D3 shows brighter fluorescence staining and its binding can be blocked by clone HI98.

940274 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940274 Rev.2
Citations & References
Down Arrow

Development References (3)

  1. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  2. Lund-Johansen F, Olweus J, Horejsi V, et al. Activation of human phagocytes through carbohydrate antigens (CD15, sialyl-CD15, CDw17, and CDw65).. J Immunol. 1992; 148(10):3221-9. (Biology). View Reference
  3. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
940274 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.