Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse γδ T-Cell Receptor

BD™ AbSeq Oligo Hamster Anti-Mouse γδ T-Cell Receptor

Clone GL3 (RUO)

25 Tests
Product Details
Down Arrow


BD™ AbSeq
Tcrd; T-cell receptor delta chain; Tcr delta
110066, 110067
2 µl
Armenian Hamster IgG2, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGGATGGTTAGGCGTTTAGGTTTCGGGTGTTATTGT
AMM2046
C57BL/6 Mouse Intestinal Intraepithelial Lymphocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
  9. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940150 Rev. 2
Antibody Details
Down Arrow
GL3

The GL3 monoclonal antibody specifically binds to a common epitope of the δ chain of the T-cell Receptor (TCR) complex on γδ TCR-expressing T lymphocytes and NK-T cells of all mouse strains tested. It does not react with αβ TCR-bearing T cells. In the mouse, cells expressing the γδ TCR are found in the thymus, intestinal epithelium, epidermis, dermis, pulmonsry epithelium, peritoneum, liver, and peripheral lymphoid organs.

940150 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940150 Rev.2
Citations & References
Down Arrow

Development References (15)

  1. Goodman T, LeCorre R, Lefrancois L. A T-cell receptor gamma delta-specific monoclonal antibody detects a V gamma 5 region polymorphism. Immunogenetics. 1992; 35(1):65-68. (Clone-specific: Flow cytometry). View Reference
  2. Goodman T, Lefrancois L. Intraepithelial lymphocytes. Anatomical site, not T cell receptor form, dictates phenotype and function. J Exp Med. 1989; 170(5):1569-1581. (Immunogen: Flow cytometry, Immunoprecipitation). View Reference
  3. Kaufmann SH, Blum C, Yamamoto S. Crosstalk between alpha/beta T cells and gamma/delta T cells in vivo: activation of alpha/beta T-cell responses after gamma/delta T-cell modulation with the monoclonal antibody GL3. Proc Natl Acad Sci U S A. 1993; 90(20):9620-9624. (Clone-specific: Depletion). View Reference
  4. King DP, Hyde DM, Jackson KA, et al. Cutting edge: protective response to pulmonary injury requires gamma delta T lymphocytes. J Immunol. 1999; 162(9):5033-5036. (Clone-specific: Flow cytometry). View Reference
  5. Lefrancois L, Barrett TA, Havran WL, Puddington L. Developmental expression of the alpha IEL beta 7 integrin on T cell receptor gamma delta and T cell receptor alpha beta T cells. Eur J Immunol. 1994; 24(3):635-640. (Clone-specific: Immunohistochemistry). View Reference
  6. Lefrancois L. Phenotypic complexity of intraepithelial lymphocytes of the small intestine. J Immunol. 1991; 147(6):1746-1751. (Clone-specific: Flow cytometry). View Reference
  7. MacDonald HR, Schreyer M, Howe RC, Bron C. Selective expression of CD8 alpha (Ly-2) subunit on activated thymic gamma/delta cells. Eur J Immunol. 1990; 20(4):927-930. (Clone-specific: Flow cytometry). View Reference
  8. Nakazawa S, Brown AE, Maeno Y, Smith CD, Aikawa M. Malaria-induced increase of splenic gamma delta T cells in humans, monkeys, and mice. 1994; 79(3):391-398. (Clone-specific: Immunohistochemistry). View Reference
  9. Shinohara K, Ikarashi Y, Maruoka H, et al. Functional and phenotypical characteristics of hepatic NK-like T cells in NK1.1-positive and -negative mouse strains. Eur J Immunol. 1999; 29(6):1871-1878. (Clone-specific: Flow cytometry). View Reference
  10. Skeen MJ, Ziegler HK. Induction of murine peritoneal gamma/delta T cells and their role in resistance to bacterial infection. J Exp Med. 1993; 178(3):971-984. (Clone-specific: Flow cytometry, In vivo exacerbation). View Reference
  11. Tamaki K, Yasaka N, Chang CH, et al. Identification and characterization of novel dermal Thy-1 antigen-bearing dendritic cells in murine skin. J Invest Dermatol. 1996; 106(3):571-575. (Clone-specific: Fluorescence microscopy, Immunofluorescence, Immunohistochemistry). View Reference
  12. Tigelaar RE, Lewis JM, Bergstresser PR. TCR gamma/delta+ dendritic epidermal T cells as constituents of skin-associated lymphoid tissue. J Invest Dermatol. 1990; 94(6):58S-63S. (Biology). View Reference
  13. Vicari AP, Mocci S, Openshaw P, O'Garra A, Zlotnik A. Mouse gamma delta TCR+NK1.1+ thymocytes specifically produce interleukin-4, are major histocompatibility complex class I independent, and are developmentally related to alpha beta TCR+NK1.1+ thymocytes. Eur J Immunol. 1996; 26(7):1424-1429. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
  14. Yanez DM, Batchelder J, van der Heyde HC, Manning DD, Weidanz WP. Gamma delta T-cell function in pathogenesis of cerebral malaria in mice infected with Plasmodium berghei ANKA. Infect Immun. 1999; 67(1):446-448. (Clone-specific: Depletion). View Reference
  15. van der Heyde HC, Elloso MM, Chang WL, Kaplan M, Manning DD, Weidanz WP. Gamma delta T cells function in cell-mediated immunity to acute blood-stage Plasmodium chabaudi adami malaria. J Immunol. 1995; 154(8):3985-3990. (Clone-specific: Depletion). View Reference
View All (15) View Less
940150 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.