Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD357 (GITR)

BD™ AbSeq Oligo Rat Anti-Mouse CD357 (GITR)

Clone DTA-1 (also known as DTA-1)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
GITR; Gitr; glucocorticoid-induced TNFR-related protein; Tnfrsf18; AITR
21936
2 µl
Rat IgG2b
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GAAGAGTATGTGCGTTTGTTAAGTTGGCGGGTATTT
AMM2084
Mouse CD25+ CD4+ T Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940188 Rev. 2
Antibody Details
Down Arrow Up Arrow
DTA-1

The DTA-1 monoclonal antibody specifically binds to GITR [Glucocorticoid-induced Tumor necrosis factor (TNF) receptor family-Related], a 66-70-kDa homodimer glycoprotein that is a member of the TNF receptor superfamily and is also known as TNFRSF18 and CD357. As its name implies, GITR expression was first detected in T lymphocytes that had been treated with dexamethasone, a glucocorticoid. In normal naive mice, GITR is expressed at moderate levels on CD25-positive/CD4-positive/CD8a-negative thymocytes and on CD25-positive/CD4-positive/CD45RB-low splenocytes. It is also expressed at low levels on splenic CD25-negative/CD4-positive/CD45RB-low T lymphocytes, B lymphocytes, macrophages, and dendritic cells. Activation of T and B lymphocytes upregulates GITR expression. GITR is a costimulatory receptor that plays an important role in Regulatory T (Treg)-cell functions, and a GITR Ligand has been detected on B lymphocytes, macrophages, and dendritic cells. mAb DTA-1 abrogates suppression by Treg cells without affecting their proliferative response, while it is co-stimulatory for T lymphocytes that are not Treg cells.

940188 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940188 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (16)

  1. Beilharz MW, Sammels LM, Paun A, et al. Timed ablation of regulatory CD4-positive T cells can prevent murine AIDS progression. J Immunol. 2004; 172:4917-4925. (Biology). View Reference
  2. Beilharz MW, Sammels LM, Paun A, et al. Timed ablation of regulatory CD4-positive T cells can prevent murine AIDS progression. J Immunol. 2004; 172:4917-4925. (Clone-specific). View Reference
  3. Dittmer U, He H, Messer RJ, et al. Functional impairment of CD8-positive T cells by regulatory T cells during persistent retroviral infection. Immunity. 2004; 20:293-303. (Clone-specific). View Reference
  4. Dittmer U, He H, Messer RJ, et al. Functional impairment of CD8-positive T cells by regulatory T cells during persistent retroviral infection. Immunity. 2004; 20:293-303. (Clone-specific: In vivo exacerbation). View Reference
  5. Ji H, Liao G, Faubion WA, et al. The natural ligand for glucocorticoid-induced TNF receptor-related protein abrogates regulatory T cell suppression. J Immunol. 2004; 172:5823-5827. (Biology). View Reference
  6. Kohm AP, Williams JS, Miller SD. Ligation of the glucocorticoid-induced TNF receptor enhances autoreactive CD4-positive T cell activation and experimental autoimmune encephalomyelitis. J Immunol. 2004; 172:4686-4690. (Clone-specific). View Reference
  7. Kohm AP, Williams JS, Miller SD. Ligation of the glucocorticoid-induced TNF receptor enhances autoreactive CD4-positive T cell activation and experimental autoimmune encephalomyelitis. J Immunol. 2004; 172:4686-4690. (Clone-specific: Flow cytometry, In vivo exacerbation). View Reference
  8. Nocentini G, Giunchi L, Ronchetti S, et al. A new member of the tumor necrosis factor/nerve growth factor receptor family inhibits T cell receptor-induced apoptosis. Proc Natl Acad Sci U S A. 1997; 94:6216-6221. (Biology). View Reference
  9. Nocentini G, Giunchi L, Ronchetti S, et al. A new member of the tumor necrosis factor/nerve growth factor receptor family inhibits T cell receptor-induced apoptosis. Proc Natl Acad Sci U S A. 1997; 94:6216-6221. (Biology). View Reference
  10. Shimizu J, Moriizumi E. CD4-positive CD25-negative T cells in aged mice are hyporesponsive and exihibit suppressive activity. J Immunol. 2003; 170:1675-1682. (Clone-specific). View Reference
  11. Shimizu J, Moriizumi E. CD4-positive CD25-negative T cells in aged mice are hyporesponsive and exihibit suppressive activity. J Immunol. 2003; 170:1675-1682. (Clone-specific: Functional assay). View Reference
  12. Shimizu J, Yamazaki S, Takahashi T, Ishida Y, Sakaguchi S. Stimulation of CD25-positive CD4-positive regulatory T cells through GITR breaks immunological self-tolerance. Nat Immunol. 2002; 3(2):135-142. (Immunogen). View Reference
  13. Shimizu J, Yamazaki S, Takahashi T, Ishida Y, Sakaguchi S. Stimulation of CD25-positive CD4-positive regulatory T cells through GITR breaks immunological self-tolerance. Nat Immunol. 2002; 3(2):135-142. (Immunogen: Cell separation, Depletion, Flow cytometry, Functional assay, Immunoprecipitation, Inhibition, In vivo exacerbation). View Reference
  14. Tone M, Tone Y, Adams E, et al. Mouse glucocorticoid-induced tumor necrosis factor receptor ligand is costimulatory for T cells. Proc Natl Acad Sci U S A. 2003; 100(25):15059-15064. (Biology). View Reference
  15. Uraushihara K, Kanai T, Ko K, et al. Regulation of murine inflammatory bowel disease by CD25-positive and CD25negative CD4-positive glucocorticoid-induced TNF receptor family-related gene-positive regulatory T cells. J Immunol. 2003; 171:708-716. (Clone-specific). View Reference
  16. Uraushihara K, Kanai T, Ko K, et al. Regulation of murine inflammatory bowel disease by CD25-positive and CD25negative CD4-positive glucocorticoid-induced TNF receptor family-related gene-positive regulatory T cells. J Immunol. 2003; 171:708-716. (Clone-specific: Cell separation, Flow cytometry, In vivo exacerbation). View Reference
View All (16) View Less
940188 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.