Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD4

BD™ AbSeq Oligo Rat Anti-Mouse CD4

Clone GK1.5

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Cd4; CD4 antigen; L3T4; Ly-4; T-cell surface antigen T4/Leu-3
12504
2 µl
Rat LEW, also known as Lewis IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGAGTCGTAGTTATAAGCGGTGGGTAGGAGTCGTTG
AMM2056
Mouse CTL clone V4
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940471 Rev. 2
Antibody Details
Down Arrow Up Arrow
GK1.5

The GK1.5 monoclonal antibody specifically binds to the mouse CD4 (L3T4) differentiation antigen. CD4 is expressed on most thymocytes, a subpopulation of mature T lymphocytes (i.e., MHC class II-restricted T cells, including most T helper cells), and a subset of NK-T cells. In addition, CD4 has also been reported to be detectable on pluripotent hematopoietic stem cells, bone marrow myeloid and B-lymphocyte precursors, intrathymic lymphoid precursors, and a subset of splenic dendritic cells. CD4 has also been reported to be expressed on the plasma membrane of mouse egg cells and is involved in adhesion of the egg to MHC class II-bearing sperm.  CD4 is an antigen coreceptor on the T-cell surface which interacts with MHC class II molecules on antigen-presenting cells. It participates in T-cell activation through its association with the T-cell receptor complex and protein tyrosine kinase lck. The GK1.5 antibody reportedly blocks binding of the RM4-5 and H129.19, but not RM4-4 mouse CD4-specific antibodies.

940471 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940471 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (10)

  1. Bosselut R, Zhang W, Ashe JM, Kopacz JL, Samelson LE, Singer A. Association of the adaptor molecule LAT with CD4 and CD8 coreceptors identifies a new coreceptor function in T cell receptor signal transduction. J Exp Med. 1999; 190(10):1517-1526. (Clone-specific: (Co)-stimulation, Immunoprecipitation). View Reference
  2. Dialynas DP, Quan ZS, Wall KA, et al. Characterization of the murine T cell surface molecule, designated L3T4, identified by monoclonal antibody GK1.5: similarity of L3T4 to the human Leu-3/T4 molecule. J Immunol. 1983; 131(5):2445-2451. (Immunogen: Blocking, Depletion, Flow cytometry). View Reference
  3. Dialynas DP, Wilde DB, Marrack P, et al. Characterization of the murine antigenic determinant, designated L3T4a, recognized by monoclonal antibody GK1.5: expression of L3T4a by functional T cell clones appears to correlate primarily with class II MHC antigen-reactivity. Immunol Rev. 1983; 74:29-56. (Clone-specific: Blocking, Depletion, Flow cytometry). View Reference
  4. Frederickson GG, Basch RS. L3T4 antigen expression by hemopoietic precursor cells. J Exp Med. 1989; 169(4):1473-1478. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
  5. Ghobrial RR, Boublik M, Winn HJ, Auchincloss H Jr. In vivo use of monoclonal antibodies against murine T cell antigens. Clin Immunol Immunopathol. 1989; 52(3):486-506. (Biology). View Reference
  6. Janeway CA Jr. The T cell receptor as a multicomponent signalling machine: CD4/CD8 coreceptors and CD45 in T cell activation. Annu Rev Immunol. 1992; 10:645-674. (Biology). View Reference
  7. Kruisbeek AM. In vivo depletion of CD4- and CD8-specific T cells. Curr Protoc Immunol. 1991; 4.1.1-4.1.5. (Clone-specific: Cytotoxicity, Depletion). View Reference
  8. Wineman JP, Gilmore GL, Gritzmacher C, Torbett BE, Muller-Sieburg CE. CD4 is expressed on murine pluripotent hematopoietic stem cells. Blood. 1992; 180(7):1717-1724. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting, Immunofluorescence, Immunoprecipitation). View Reference
  9. Wu L, Antica M, Johnson GR, Scollay R, Shortman K. Developmental potential of the earliest precursor cells from the adult mouse thymus. J Exp Med. 1991; 174(6):1617-1627. (Biology). View Reference
  10. Zheng B, Han S, Kelsoe G. T helper cells in murine germinal centers are antigen-specific emigrants that downregulate Thy-1. J Exp Med. 1996; 184(3):1083-1091. (Clone-specific: Immunohistochemistry). View Reference
View All (10) View Less
940471 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.