Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD61

BD™ AbSeq Oligo Mouse Anti-Human CD61

Clone VI-PL2 (also known as VIPL2) (RUO)

940065
EA (1 Each)
25 Tests
Add Product To QuoteAdd to Quote
Product Details
Down Arrow


BD™ AbSeq
Integrin β3; Integrin beta-3; GP3A; GPIIIa; ITGB3; ITB3
3690
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CGGGTTTAAGGATTGCGTTCGTCGGTAGTAGTGAGT
AHS0069
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940065 Rev. 3
Antibody Details
Down Arrow
VI-PL2

The VI-PL2 monoclonal antibody specifically binds to CD61. CD61 is a 105 kDa transmembrane glycoprotein that is also known as integrin β3 and platelet glycoprotein IIIa (GPIIIa or GP3A). It is expressed on platelets, megakaryocytes, osteoclasts and endothelia. Integrin β3 associates with gpIIa (CD41) to form the CD41/CD61 complex which mediates platelet adhesion and aggregation. CD61 also associates with CD51 to form the CD51/CD61 complex (vitronectin receptor). CD61 appears to bind to fibrinogen, fibronectin, vWF, vitronectin, and thrombospondin to mediate cell adhesion.

940065 Rev. 3
Citations & References
Down Arrow

Development References (6)

  1. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  2. Knapp W, Dorken B, Rieber P, Schmidt RE, Stein H, von dem Borne AE. CD Antigens 1989: Summary of Nomenclature System for Human Leacocyte Surface Antigens. Am J Pathol. 1989; 135(2):420-421. (Clone-specific: Flow cytometry). View Reference
  3. Lin G-X, Yang X, Hollemweguer E, et al. Cross-reactivity of CD antibodies in eight animal species. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:519-523.
  4. Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002.
  5. Modderman PW. Cluster report: CD61. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1025.
  6. Yu J-F, Yang X-F, Nguyen E, et al. Seventh HLDA Workshop—Cytokine Receptor Section: Flow cytometric analysis on 11 different target cells. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:275-278.
View All (6) View Less
940065 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.