Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD274 (B7-H1)

BD™ AbSeq Oligo Mouse Anti-Human CD274 (B7-H1)

Clone MIH1 (RUO)

940035
EA (1 Each)
25 Tests
Add Product To QuoteAdd to Quote
Product Details
Down Arrow


BD™ AbSeq
B7-H1; B7-H; PD-L1; PDL1; PDCD1 ligand 1; PDCD1L1; PDCD1LG1
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATCGTAAGGCTCGTGGTTCGTAAGTAAGTTCGTATC
AHS0004
Human CD274 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940035 Rev. 4
Antibody Details
Down Arrow
MIH1

The MIH1 monoclonal antibody specifically binds to CD274, which is also known as, B7 homolog 1 (B7-H1), Programmed cell death 1 ligand 1 (PDCD1 ligand, PDCD1L1, PDCD1LG1), or Programmed death ligand 1 (PD-L1, PDL1). CD274 and PD-L2 (CD273) are type I transmembrane glycoproteins that belong to the B7 family and serve as ligands for CD279 (Program Death 1/PD-1). CD274 is expressed on antigen-presenting cells including activated monocytes/macrophages and dendritic cells, as well as, activated T cells, and keratinocytes. CD274 is also expressed on placental trophoblasts, myocardial endothelium, cortical thymic epithelial cells, and on most carcinomas. CD274 plays an important role in regulating T cell responses. The MIH1 antibody blocks CD279 binding to CD274 and can enhance the proliferation and cytokine production of activated T cells.

940035 Rev. 4
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940035 Rev.4
Citations & References
Down Arrow

Development References (7)

  1. Brown JA, Dorfman DM, Ma FR, et al. Blockade of programmed death-1 ligand on dendritic cells enhances T cell activation and cytokine production. J Immunol. 2003; 170:1257-1266. (Biology). View Reference
  2. Carreno BM, Bennett F, Chau TA, et al. CTLA-4 (CD152) can inhibit T cell activation by two different mechanisms depending on its level of cell surface expression.. J Immunol. 2000; 165(3):1352-6. (Biology). View Reference
  3. Carter L, Fouser LA, Jussif J, et al. PD-1:PD-L inhibitory pathway affects both CD4(+) and CD8(+) T cells and is overcome by IL-2. Eur J Immunol. 2002; 32:634-643. (Biology). View Reference
  4. Freeman GJ, Long AJ, Iwai Y, et al. Engagement of PD-1 immunoinhibitory receptor by a novel B7 family member leads to negative regulation of lymphocyte activation. J Exp Med. 2000; 192:1027-1034. (Biology). View Reference
  5. Latchman Y, Wood CR, Chernova T, et al. PD-L2 is a second ligand for PD-1 and inhibits T cell activation. Nat Immunol. 2001; 2(3):261-268. (Biology). View Reference
  6. Youngnak P, Kozono Y, Kozono H, et al. Differential binding properties of B7-H1 and B7-DC to programmed death-1. Biochem Biophys Res Commun. 2003; 307(3):672-677. (Immunogen: Flow cytometry). View Reference
  7. Youngnak-Piboonratanakit P, Tsushima F, Otsuki N, et al. The expression of B7-H1 on keratinocytes in chronic inflammatory mucocutaneous disease and its regulatory role. Immunol Lett. 2004; 94(3):215-222. (Clone-specific: Blocking, (Co)-stimulation, Flow cytometry, Fluorescence microscopy, Functional assay, Immunofluorescence, Immunohistochemistry). View Reference
View All (7) View Less
940035 Rev. 4

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.