Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD16

BD™ AbSeq Oligo Mouse Anti-Human CD16

Clone B73.1 (RUO)

940314
EA (1 Each)
25 Tests
Add Product To QuoteAdd to Quote
Product Details
Down Arrow


BD™ AbSeq
IgG Fc receptor III; IGFR3; FCG3; FCGR3; FCGRIII; FcγRIII
2214, 2215
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GCGTTTGTAGTAAGGAGATCTGCGAATAGCGTAGGG
AHS0242
Human NK Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940314 Rev. 2
Antibody Details
Down Arrow
B73.1

The B73.1 monoclonal antibody specifically binds to CD16, the 50-70 kDa low affinity receptor for IgG, IgG Fc receptor III (FcγRIII). CD16 is expressed on NK cells, neutrophils, and on a subset of T cells from certain individuals. The B73.1 antibody binds to CD16-positive neutrophils with lower intensity when compared with some other CD16-specific antibodies. A variable number of CD16-positive lymphocytes coexpress either the CD57 antigen or low-density CD8 antigen or both. The B73.1 antibody can block Fc receptor functions mediated by CD16.

940314 Rev. 2
Citations & References
Down Arrow

Development References (7)

  1. Lanier LL, Kipps TJ, Phillips JH. Functional properties of a unique subset of cytotoxic CD3+ T lymphocytes that express Fc receptors for IgG (CD16/Leu-11 antigen). J Exp Med. 1985; 162(6):2089-2106. (Clone-specific: Flow cytometry). View Reference
  2. Lanier LL, Le AM, Civin CI, Loken MR, Phillips JH. The relationship of CD16 (Leu-11) and Leu-19 (NKH-1) antigen expression on human peripheral blood NK cells and cytotoxic T lymphocytes. J Immunol. 1986; 136(12):4480-4486. (Biology). View Reference
  3. Lanier LL, Le AM, Phillips JH, Warner NL, Babcock GF. Subpopulations of human natural killer cells defined by expression of the Leu-7 (HNK-1) and Leu-11 (NK-15) antigens. J Immunol. 1983; 131(4):1789-1796. (Biology). View Reference
  4. Perussia B, Acuto O, Terhorst C, et al. Human natural killer cells analyzed by B73.1, a monoclonal antibody blocking Fc receptor functions. II. Studies of B73.1 antibody-antigen interaction on the lymphocyte membrane. J Immunol. 1983; 130(5):2142-2148. (Clone-specific: Blocking, Flow cytometry, Immunoprecipitation, Radioimmunoassay). View Reference
  5. Perussia B, Starr S, Abraham S, Fanning V, Trinchieri G. Human natural killer cells analyzed by B73.1, a monoclonal antibody blocking Fc receptor functions. I. Characterization of the lymphocyte subset reactive with B73.1. J Immunol. 1983; 130(5):2133-2141. (Immunogen: Cell separation, Flow cytometry). View Reference
  6. Perussia B, Trinchieri G, Jackson A, et al. The Fc receptor for IgG on human natural killer cells: phenotypic, functional, and comparative studies with monoclonal antibodies. J Immunol. 1984; 133(1):180-189. (Clone-specific: Blocking, Flow cytometry). View Reference
  7. Schmidt RE. Non-lineage/natural killer section report: new and previously defined clusters. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:517-542.
View All (7) View Less
940314 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.