If you notice text formatting issues, please update your browser to view the website correctly
See More
Product Details
BD™ AbSeq
SELE; E-selectin; Selectin E; ELAM; ELAM1; ESEL; LECAM2
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGAGAGGAGTAGGTCGACAGTTTAAGGCGCAGAAGT
AHS0254
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Preparation And Storage
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
Recommended Assay Procedures
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.
BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Product Notices
- This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
- Source of all serum proteins is from USDA inspected abattoirs located in the United States.
- Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
- The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
- Illumina is a trademark of Illumina, Inc.
- Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
- Please refer to bd.com/genomics-resources for technical protocols.
- For U.S. patents that may apply, see bd.com/patents.
Companion Products
Human BD Fc Block™ RUO
Size
50 µg
Cat No.
564219
Human BD Fc Block™ RUO
Size
0.25 µg
Cat No.
564220
Stain Buffer (FBS) RUO
Size
500 ML
Cat No.
554656
Single-Cell Analysis System RUO
Size
1 EA
Cat No.
633701
Express Single-Cell Analysis System Package RUO
Size
1 EA
Cat No.
633707
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
Size
1 Each
Cat No.
633772
940377 Rev. 2
Antibody Details
68-5H11
The 68-5H11 monoclonal antibody specifically binds to CD62E. This adhesion molecule is a 97-115 kDa type I transmembrane glycoprotein that is encoded by the SELE gene. CD62E is also known as E-selectin, Endothelial-leukocyte adhesion molecule-1 (ELAM-1), and Leukocyte endothelial cell adhesion molecule 2 (LECAM-2). CD62E is minimally expressed by unstimulated endothelium. Activated endothelial cells upregulate surface CD62E expression in response to various activators including inflammatory cytokines such as Interleukin-1 and Tumor Necrosis Factor. CD62E plays a role in leucocyte extravasation by promoting leucocyte rolling on activated endothelial cells during inflammation. CD62E may also play a role in the metastasis of certain tumor cells. The adhesion between endothelial CD62E molecules and a carbohydrate ligand on neutrophils is inhibited by the mAb 68-5H11.
940377 Rev. 2
Format Details
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940377 Rev.2
Citations & References
View product citations for antibody "940377" on CiteAb
Development References (5)
-
Bevilacqua MP, Stengelin S, Gimbrone MA Jr, Seed B. Endothelial leukocyte adhesion molecule 1: an inducible receptor for neutrophils related to complement regulatory proteins and lectins. Science. 1989; 243(4895):1160-1165. (Biology). View Reference
-
Goda K, Tanaka T, Takeuchi E, Miyasaka M. CD62E Workshop Panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:416-418.
-
Phillips ML, Nudelman E, Gaeta FC, et al. ELAM-1 mediates cell adhesion by recognition of a carbohydrate ligand, sialyl-Lex. Science. 1990; 250(4984):1130-1132. (Biology). View Reference
-
Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
-
Vermont-Desroches C, Roy C, Marchand D, Wijdenes J. CD62E Workshop: The Workshop "CD62E," CD62L," "CD102" and "CD106" monoclonal antibodies: Analysis of the monoclonal antibody specificity, epitope mapping, and biological activity. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:418-419.
940377 Rev. 2
Please refer to Support Documents for Quality Certificates
Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described
Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.
For Research Use Only. Not for use in diagnostic or therapeutic procedures.