Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD28

BD™ AbSeq Oligo Mouse Anti-Human CD28

Clone CD28.2 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD28 antigen; T44; Tp44; TP44
940, 705313, 100126740, 102146670
2 µl
Mouse C3H x BALB/c IgG1, κ
Human, Rhesus, Cynomolgus, Baboon (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTGGTTTCGTAAGCGGCTAAGCGTATCTCGTGTTTG
AHS0024
Human CD28 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. Please refer to bd.com/genomics-resources for technical protocols.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Species cross-reactivity detected in product development may not have been confirmed on every format and/or application.
  6. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  7. Illumina is a trademark of Illumina, Inc.
  8. This product is sold under license. Purchase of this product does not include rights to (i) incorporate this product into the purchaser's own products for resale to end-users, or (ii) use this product to conduct for-profit research for or on behalf of another party. For information on obtaining a license to this product for such prohibited uses, contact INSERM, 7 rue Watt, 75013 Paris. Telephone: +33 1 55 03 01 60. Facsimile: +33 1 55 03 01 18. Email: techtransfert@inserm-transfert.fr
  9. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  10. For U.S. patents that may apply, see bd.com/patents.
940017 Rev. 5
Antibody Details
Down Arrow Up Arrow
CD28.2

The CD28.2 monoclonal antibody specifically binds to CD28, a 44 kDa homodimeric transmembrane glycoprotein present on most mature T cells, thymocytes and plasma cells. CD28 is a costimulatory receptor that binds CD80 and CD86 as ligands and plays a very important role in T cell-B cell interactions. It has been suggested that CD28 initiates and regulates a separate and distinct signal transduction pathway from those stimulated by the TCR complex. Additionally, it has been reported that CD28 antibody clones vary in their ability to stimulate T cells to produce IL-2 and increase intracellular Ca2+ concentration. This finding suggests the existence of functionally distinct subregions on the CD28 molecule. CD28.2 has been demonstrated to bind to the same molecule as clone L293, another CD28 mAb, and has been reported to induce Ca2+ influx in Jurkat T cells.

940017 Rev. 5
Format Details
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940017 Rev.5
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940017" on CiteAb

Development References (11)

  1. Barclay NA, Brown MH, Birkeland ML, et al, ed. The Leukocyte Antigen FactsBook. San Diego, CA: Academic Press; 1997.
  2. Bjornson-Hooper ZB, Fragiadakis GK, Spitzer MH, et al. A Comprehensive Atlas of Immunological Differences Between Humans, Mice, and Non-Human Primates.. Front Immunol. 2022; 13:867015. (Clone-specific: Flow cytometry). View Reference
  3. Guo H, Lu L, Wang R, et al. Impact of Human Mutant TGFβ1/Fc Protein on Memory and Regulatory T Cell Homeostasis Following Lymphodepletion in Nonhuman Primates.. Am J Transplant.. 2016; 16(10):2994-3006. (Clone-specific: Flow cytometry). View Reference
  4. June CH, Bluestone JA, Nadler LM, Thompson CB. The B7 and CD28 receptor families. Immunol Today. 1994; 15(7):321-331. (Biology). View Reference
  5. Kuiper H, Brouwer M, Vermeire S, van Lier R. Analysis of the Workshop CD28 Panel mAb: distinct signalling pathways coupled to CD28. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:373-374.
  6. Lin G-X, Yang X, Hollemweguer E, et al. Cross-reactivity of CD antibodies in eight animal species. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:519-523.
  7. Nunes J, Klasen S, Franco MD, et al. Signalling through CD28 T-cell activation pathway involves an inositol phospholipid-specific phospholipase C activity. Biochem J. 1993; 293(3):835-842. (Clone-specific: Calcium Flux, (Co)-stimulation, Functional assay). View Reference
  8. Nunes J, Klasen S, Ragueneau M, et al. CD28 mAbs with distinct binding properties differ in their ability to induce T cell activation: analysis of early and late activation events. Int Immunol. 1993; 5(3):311-315. (Immunogen: Calcium Flux, (Co)-stimulation, Flow cytometry, Functional assay, IC/FCM Block, Immunoprecipitation, Stimulation). View Reference
  9. Olive D, Cerdan C, Costello R, et al. CD28 and CTLA-4 cluster report. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:360-370.
  10. Thaker YR, Schneider H, Rudd CE. TCR and CD28 activate the transcription factor NF-κB in T-cells via distinct adaptor signaling complexes.. Immunol Lett. 2015; 163(1):113-9. (Clone-specific: Activation, Flow cytometry). View Reference
  11. Tonsho M, Lee S, Aoyama A, et al. Tolerance of Lung Allografts Achieved in Nonhuman Primates via Mixed Hematopoietic Chimerism. Am J Transplant.. 2015; 15(8):2231-9. (Clone-specific: Flow cytometry). View Reference
View All (11) View Less
940017 Rev. 5

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.