Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD102

BD™ AbSeq Oligo Mouse Anti-Human CD102

Clone CBR-IC2/2

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
ICAM2; ICAM-2; Intercellular adhesion molecule 2
3384
2 µl
Mouse BALB/c IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTTGGATTGGGTCGGTAGGATTTGGTCGGGTTTAGT
AHS0155
Human ICAM-2 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940241 Rev. 2
Antibody Details
Down Arrow Up Arrow
CBR-IC2/2

The CBR-IC2/2 monoclonal antibody specifically binds to CD102 which is also known as, intercellular adhesion molecule-2 (ICAM-2/ICAM2). CD102 is a type I transmembrane glycoprotein, member of the immunoglobulin supergene family, with an approximate molecular weight of 55-65 kDa. Its extracellular domain consists of two C2-type immunoglobulin-like subunits. The transmembrane region is 26 residues in size and the intracellular region also has 26 residues. CD102 is expressed on vascular endothelial cells, lymphocytes, monocytes, eosinophils, and platelets, but not on resting neutrophils. It is a ligand for the leukocyte integrin CD11a/CD18, or leukocyte function-associated antigen-1 (LFA-1), and there are reports of CD102 binding to leukocyte integrin CD11b/CD18 (Mac-1). Antibody CBR-IC2/2 blocks the binding of CD102 to leukocyte integrin CD11a/CD18. CD102 plays an important role in lymphocyte recirculation and in providing costimulatory signals in the immune response.

940241 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940241 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940241" on CiteAb

Development References (4)

  1. Klickstein LB, Springer TA. CD102 (ICAM-2) cluster report. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:1550-1551.
  2. Xie J, Li R, Kotovuori P, et al. Intercellular adhesion molecule-2 (CD102) binds to the leukocyte integrin CD11b/CD18 through the A domain. J Immunol. 1995; 155(7):3619-3628. (Biology). View Reference
  3. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
  4. de Fougerolles AR, Stacker SA, Schwarting R, Springer TA. Characterization of ICAM-2 and evidence for a third counter-receptor for LFA-1. J Exp Med. 1991; 174(1):253-267. (Immunogen: ELISA, Flow cytometry, Functional assay, Immunohistochemistry, Immunoprecipitation, Inhibition). View Reference
940241 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.