Skip to main content Skip to navigation

BD™ AbSeq Oligo Hamster Anti-Mouse Vγ 3 TCR

Clone 536 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
TCR Vγ3; TCR V gamma 3; TCR Vg3
110067
2 µl
Syrian Hamster IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TCGTCGGTGGAAAGAGTAAGCGCAAGATAGGATAGG
AMM2158
AKR mouse dendritic epidermal cell clone 7-17
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Syrian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
  8. Please refer to bd.com/genomics-resources for technical protocols.
  9. For U.S. patents that may apply, see bd.com/patents.
940354 Rev. 2
Antibody Details
Down Arrow Up Arrow
536

The 536 monoclonal antibody specifically recognizes Vγ 3† T-cell Receptor (TCR)-bearing T lymphocytes, which are the predominant γδ TCR-bearing cells in the early fetal thymus and the adult epidermis of euthymic mice.  The first T cells to mature in the embryonic thymus express the Vγ 3 and Vδ 1 TCR chains, and their development is dependent upon IL-7.  There is evidence that the Vγ 3 TCR-bearing fetal thymocytes are the precursors of the majority of dendritic epidermal T cells (DEC), which may be replenished in the adult by proliferation in situ rather than by seeding from primary lymphoid organs.  Although the Vγ 3 TCR is almost exclusively found in the DEC population, it has been shown that the homing of DEC to the epidermis does not require expression of the Vγ 3 gene segment.  Vγ 3 TCR-bearing dermal dendritic cells have also been described. Vγ 3 TCR has also been found on a subset of T lymphocytes in the lactating mammary gland and at the site of antigenic challenge in contact-sensitized mice.  Plate-bound 536 antibody activates Vγ 3 TCR-bearing T cells, and Fab fragments of mAb 536 block in vitro stimulation of DEC by keratinocytes.

† Please note that the Vγ 3 designation correlates with the nomenclature of Garman, Doherty, and Raulet; the Vγ 5 designation of Heilig and Tonegawa is equivalent.

940354 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940354 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940354" on CiteAb

Development References (17)

  1. Boismenu R, Havran WL. Modulation of epithelial cell growth by intraepithelial gamma delta T cells. Science. 1994; 266(5188):1253-1255. (Biology). View Reference
  2. Bonneville M, Itohara S, Krecko EG, et al. Transgenic mice demonstrate that epithelial homing of gamma/delta T cells is determined by cell lineages independent of T cell receptor specificity. J Exp Med. 1990; 171(4):1015-1026. (Biology). View Reference
  3. Dieli F, Asherson GL, Sireci G, et al. gamma delta cells involved in contact sensitivity preferentially rearrange the Vgamma3 region and require interleukin-7. Eur J Immunol. 1997; 27(1):206-214. (Biology). View Reference
  4. Havran WL, Allison JP. Developmentally ordered appearance of thymocytes expressing different T-cell antigen receptors. Nature. 1988; 335(6189):443-445. (Clone-specific). View Reference
  5. Havran WL, Allison JP. Origin of Thy-1+ dendritic epidermal cells of adult mice from fetal thymic precursors. Nature. 1990; 344(6261):68-70. (Biology). View Reference
  6. Havran WL, Chien YH, Allison JP. Recognition of self antigens by skin-derived T cells with invariant gamma delta antigen receptors. Science. 1991; 252(5011):1430-1432. (Biology). View Reference
  7. Havran WL, Grell S, Duwe G, Kimura J. Limited diversity of T-cell receptor gamma-chain expression of murine Thy-1+ dendritic epidermal cells revealed by V gamma 3-specific monoclonal antibody. Proc Natl Acad Sci U S A. 1989; 86(11):4185-4189. (Immunogen). View Reference
  8. Havran WL, Poenie M, Tigelaar RE, Tsien RY, Allison JP. Phenotypic and functional analysis of gamma delta T cell receptor-positive murine dendritic epidermal clones. J Immunol. 1989; 142(5):1422-1428. (Biology). View Reference
  9. Hayday A, Pao W. T cell receptor, γδ. In: Delves PJ, Roitt IM, ed. Encyclopedia of Immunology. San Diego: Academic Press; 1998:2268-2278.
  10. Kelly KA, Pearse M, Lefrancois L, Scollay R. Emigration of selected subsets of gamma delta + T cells from the adult murine thymus. Int Immunol. 1993; 5(4):331-335. (Biology). View Reference
  11. Mallick-Wood CA, Lewis JM, Richie LI, Owen MJ, Tigelaar RE, Hayday AC. Conservation of T cell receptor conformation in epidermal gammadelta cells with disrupted primary Vgamma gene usage. Science. 1998; 279(5357):1729-1733. (Biology). View Reference
  12. Moore TA, von Freeden-Jeffry U, Murray R, Zlotnik A. Inhibition of gamma delta T cell development and early thymocyte maturation in IL-7 -/- mice. J Immunol. 1996; 157(6):2366-2373. (Biology). View Reference
  13. Payer E, Elbe A, Stingl G. Circulating CD3+/T cell receptor V gamma 3+ fetal murine thymocytes home to the skin and give rise to proliferating dendritic epidermal T cells. J Immunol. 1991; 146(8):2536-2543. (Biology). View Reference
  14. Raulet DH, Spencer DM, Hsiang YH. Control of gamma delta T-cell development. Immunology. 1991; 120:185-204. (Biology). View Reference
  15. Reardon C, Lefrancois L, Farr A, Kubo R, O'Brien R, Born W. Expression of gamma/delta T cell receptors on lymphocytes from the lactating mammary gland. J Exp Med. 1990; 172(4):1263-1266. (Biology). View Reference
  16. Tamaki K, Yasaka N, Chang CH, et al. Identification and characterization of novel dermal Thy-1 antigen-bearing dendritic cells in murine skin. J Invest Dermatol. 1996; 106(3):571-575. (Biology). View Reference
  17. van Oers NS, Lowin-Kropf B, Finlay D, Connolly K, Weiss A. alpha beta T cell development is abolished in mice lacking both Lck and Fyn protein tyrosine kinases. Immunity. 1996; 5(5):429-436. (Clone-specific: Immunofluorescence). View Reference
View All (17) View Less
940354 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.