Skip to main content Skip to navigation
Hamburger Menu
Search icon
Country Selector Country Selector
Germany (English)
Profile Icon Profile Icon
Sign-in/Register UserName
Products

Solutions

Discover & Learn

Resources & Tools

Support

Search icon Search icon
Close Menu
      Alert Icon
      Oligo Rat Anti-Mouse CD9

      BD™ AbSeq Oligo Rat Anti-Mouse CD9

      Clone KMC8 (also known as KMC 8)

      (RUO)
      Product Details
      Down Arrow Up Arrow


      BD™ AbSeq
      Cd9; Tetraspanin-29; Tspan29
      12527
      2 µl
      Rat LOU, also known as Louvain, LOU/C, LOU/M IgG2a, κ
      Mouse (Tested in Development)
      Single Cell 3' Sequencing (Qualified)
      GTAGGGTATCCGGAGAAGCGTAAAGTATGACATGGG
      AMM2096
      (C57BL/6 x DBA/2)F1 mouse bone marrow-derived stromal cell line BMS2
      Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
      RUO
      Rat


      Preparation And Storage

      Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
      Show More blue down arrow Show Less blue up arrow

      Recommended Assay Procedures

      Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

      BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

      Show More blue down arrow Show Less blue up arrow

      Product Notices

      1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
      2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
      3. Please refer to bd.com/genomics-resources for technical protocols.
      4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
      5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
      6. Illumina is a trademark of Illumina, Inc.
      7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
      8. For U.S. patents that may apply, see bd.com/patents.
      Show More blue down arrow Show Less blue up arrow
      940200 Rev. 2
      Antibody Details
      Down Arrow Up Arrow
      KMC8

      The KMC8 monoclonal antibody specifically binds to CD9 which is also known as Tetraspanin-29 (Tspan29). CD9 is a 24-kDa member of the transmembrane 4 superfamily, also called the tretraspanin family. In the mouse, CD9 is present on bone marrow myeloid cells, stromal cells, and megakaryocyte-committed progenitors; subsets of peripheral T and B lymphocytes; and neutrophils, platelets, dendritic cells, and bone marrow-derived macrophages. CD9 has been found to be associated with integrins and other cell-surface receptors. It appears to play roles in signal transduction and in regulating cellular adhesive properties. CD9 can also reportedly participate in T-cell costimulation and induction of apoptosis. The KMC8 antibody reportedly blocks certain CD9 functions and activates macrophages.

      940200 Rev. 2
      Format Details
      Down Arrow Up Arrow
      Antibody-Oligo
      The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
      Antibody-Oligo
      940200 Rev.2
      Citations & References
      Down Arrow Up Arrow

      Development References (9)

      1. Jennings LK, Crossno JT Jr, Fox CF, White MM, Green CA. Platelet p24/CD9, a member of the tetraspanin family of proteins. Ann N Y Acad Sci. 1994; 714:175-184. (Biology). View Reference
      2. Kaji K, Takeshita S, Miyake K, Takai T, Kudo A. Functional association of CD9 with the Fc gamma receptors in macrophages. J Immunol. 2001; 166(5):3256-3265. (Clone-specific: Activation). View Reference
      3. Miyake K, Medina KL, Hayashi S, Ono S, Hamaoka T, Kincade PW. Monoclonal antibodies to Pgp-1/CD44 block lympho-hemopoiesis in long-term bone marrow cultures. J Exp Med. 1990; 171(2):477-488. (Immunogen: ELISA). View Reference
      4. Nakorn TN, Miyamoto T, Weissman IL. Characterization of mouse clonogenic megakaryocyte progenitors. Proc Natl Acad Sci U S A. 2003; 100(1):205-210. (Biology). View Reference
      5. Oritani K, Wu X, Medina K, et al. Antibody ligation of CD9 modifies production of myeloid cells in long-term cultures. Blood. 1996; 87(6):2252-2261. (Immunogen: Blocking). View Reference
      6. Park CS, Yashiro Y, Tai XG, et al. Differential involvement of a Fas-CPP32-like protease pathway in apoptosis of TCR/CD9-costimulated, naive T cells and TCR-restimulated, activated T cells.. J Immunol. 1998; 160(12):5790-6. (Clone-specific: Apoptosis, (Co)-stimulation). View Reference
      7. Pulendran B, Lingappa J, Kennedy MK, et al. Developmental pathways of dendritic cells in vivo: distinct function, phenotype, and localization of dendritic cell subsets in FLT3 ligand-treated mice. J Immunol. 1997; 159(5):2222-2231. (Biology). View Reference
      8. Tanio Y, Yamazaki H, Kunisada T, Miyake K, Hayashi SI. CD9 molecule expressed on stromal cells is involved in osteoclastogenesis. Exp Hematol. 1999; 27(5):853-859. (Clone-specific: Blocking). View Reference
      9. Wright MD, Tomlinson MG. The ins and outs of the transmembrane 4 superfamily. Immunol Today. 1994; 15(12):588-594. (Biology). View Reference
      View All (9) View Less
      940200 Rev. 2

      Please refer to Support Documents for Quality Certificates


      Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


      Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

      For Research Use Only. Not for use in diagnostic or therapeutic procedures.

      Website Feedback