Skip to main content Skip to navigation
Oligo Rat Anti-Human Lgr5 (N-Terminal)

BD™ AbSeq Oligo Rat Anti-Human Lgr5 (N-Terminal)

Clone 8F2 (RUO)

Sign In
25 Tests
Product Details
Down Arrow


BD™ AbSeq
GPR49, GPR67, HG38
8549
2 µl
Rat IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGTCGGTGATTAAGTTCGGGATGCTCGTGTAGTGTT
AHS0233
Human LGR5
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940308 Rev. 2
Antibody Details
Down Arrow
8F2

Lgr5 (leucine-rich-repeat-containing G-protein-coupled receptor 5)  is a seven transmembrane-domain receptor that is a target gene for Wnt and marks stem cells in the small intestine, colon, stomach, and hair follicle. Lgr5 was initially identified as a potential stem cell marker due to restricted expression of Lgr5 in the intestinal crypt and labeling of rapidly cycling cells of the colon and intestine. Using both lineage tracing and organoid culture experiments, Lgr5 positive cells are capable of generating all types of the small intestine epithelium hence indicating that Lgr5 marks stem cells of the small intestine and colon. R-spondin growth factors, which are secreted agonists of the Wnt pathway, bind Lgr5. The binding of R-spondins to Lgr5 leads to recruitment of the Frizzled/LRP Wnt receptor complex, which binds to Wnt ligands and leads to downstream Wnt signaling. Lgr5 is up-regulated in colon and ovarian cancers and has been implicated in promotion of tumor growth and metastasis.

The 8F2 monoclonal antibody recognizes an epitope in the N-terminal region of Human Lgr5.

940308 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940308 Rev.2
Citations & References
Down Arrow

Development References (8)

  1. Barker N, Huch M, Kujala P, et al. Lgr5(+ve) stem cells drive self-renewal in the stomach and build long-lived gastric units in vitro. Cell Stem Cell. 2010; 6(1):25-36. (Biology). View Reference
  2. Barker N, van Es JH, Kuipers J, Kujala P, van den Born M, et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature. 2007; 449(7165):1003-1007. (Biology). View Reference
  3. Carmon KS, Gong X, Lin Q, Thomas A, Liu Q. R-spondins function as ligands of the orphan receptors LGR4 and LGR5 to regulate Wnt/{beta}-catenin signaling. Proc Natl Acad Sci U S A. 2011; 108(28):11452-11457. (Biology). View Reference
  4. Jaks V, Barker N, Kasper M, et al. Lgr5 marks cycling, yet long-lived, hair follicle stem cells. Nat Genet. 2008; 40(11):1291-1299. (Biology). View Reference
  5. Kemper K, Prasetyanti PR, de Lau W, Rodermond H, Clevers H, Medema JP. Monoclonal antibodies against Lgr5 identify human colorectal cancer stem cells. Stem Cells. 2012; 30(11):2378-2386. (Biology). View Reference
  6. Merlos-Suárez A, Barriga FM, Jung P et al. The intestinal stem cell signature identifies colorectal cancer stem cells and predicts disease relapse. Cell Stem Cell. 2011; 8(5):511-524. (Biology). View Reference
  7. Yui S, Nakamura T, Sato T, et al. Functional engraftment of colon epithelium expanded in vitro from a single adult Lgr5(+) stem cell. Nat Med. 2012; 18(4):618-623. (Biology). View Reference
  8. de Lau W, Barker N, Low TY, et al. Lgr5 homologues associate with Wnt receptors and mediate R-spondin signalling. Nature. 2011; 476(7360):293-297. (Immunogen: Blocking). View Reference
View All (8) View Less
940308 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.