Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD21

BD™ AbSeq Oligo Mouse Anti-Human CD21

Clone 1048

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
CR2; Complement receptor type 2; C3DR; EBV-R; Epstein-Barr virus receptor
1380
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TCATGGTAACAAGGGTCGAATATAAGAGGGCGCACG
AHS0217
Human CR2 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940368 Rev. 2
Antibody Details
Down Arrow Up Arrow
1048

CD21 is a 145 kDa transmembrane glycoprotein that is expressed on mature B cells, follicular dendritic cells, a subset of immature thymocytes and on some epithelial cells. CD21 is also known as the C3d Receptor, Complement Receptor 2 (CR2), and the Epstein-Barr Virus receptor, (EBV-R). CD21 is part of a large signal-transduction complex that also includes CD19, CD81 and Leu13. CR2 serves as a receptor for the activation fragments of complement component C3, i.e. C3d, iC3d, and C3dg and C3d-bound antigens and plays a central role in the immune response by amplifying B-cell activation and proliferation. CR2 is also the receptor for EBV by binding its surface glycoprotein gp350/220. Anti-human CR2 hybridomas were generated from Cr2-/-mice (lacking the cr2 gene, that encodes CR2 and CR1 in mice) immunized with the recombinant protein representing the first two amino-terminal short consensus repeats (SRC) of human CR2, SCR1-2. Both the C3d and EBV binding sites of hu CR2 were localized to these sites. Clone 1048 has been reported to specifically react with CR2-expressing cells and to inhibit CR2 interactions with C3 fragments or the EBV surface protein, gp350/220.

940368 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940368 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (4)

  1. Carel JC, Myones BL, Frazier B, Holers VM. Structural requirements for C3d,g/Epstein-Barr virus receptor (CR2/CD21) ligand binding, internalization, and viral infection. J Biol Chem. 1990; 265(21):12293-12299. (Biology). View Reference
  2. Cooper NR, Moore MD, Nemerow GR. Immunobiology of CR2, the B lymphocyte receptor for Epstein-Barr virus and the C3d complement fragment. Annu Rev Immunol. 1988; 6:85-113. (Biology). View Reference
  3. Guthridge JM, Young K, Gipson MG, et al. Epitope mapping using the X-ray crystallographic structure of complement receptor type 2 (CR2)/CD21: identification of a highly inhibitory monoclonal antibody that directly recognizes the CR2-C3d interface.. J Immunol. 2001; 167(10):5758-66. (Immunogen: Blocking, ELISA, Flow cytometry, Functional assay, Inhibition, Western blot). View Reference
  4. Szakonyi G, Guthridge JM, Li D, Young K, Holers VM, Chen XS. Structure of complement receptor 2 in complex with its C3d ligand. Science. 2001; 293(5522):1725-1728. (Biology). View Reference
940368 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.