Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse Vβ 8.3 T-Cell Receptor

BD™ AbSeq Oligo Hamster Anti-Mouse Vβ 8.3 T-Cell Receptor

Clone 1B3.3 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
TCR V beta 8.3; TCR Vβ8.3
2 µl
Armenian Hamster IgG3, λ1
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGAGAGGATTGCGTTGGGTGTATTAAGATGCGATTG
AMM2157
Vβ 8.3 TCR-expressing mouse Th1 clone 3.L2
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
  9. Please refer to bd.com/genomics-resources for technical protocols.
940353 Rev. 1
Antibody Details
Down Arrow Up Arrow
1B3.3

The 1B3.3 antibody reacts with the Vβ 8.3 T-cell Receptor (TCR), but not the Vβ 8.1 nor Vβ 8.2 TCR, of mice having the b haplotype (e.g., A, AKR, BALB/c, CBA/Ca, CBA/J, C3H/He, C57BL, C58, DBA/1, DBA/2) of the Tcrb gene complex. The Tcrb-V8 subfamily gene loci are deleted in mice having the a (e.g., C57BR, C57L, SJL, SWR) or c (e.g., RIII) haplotype. Vβ 8.3 is one of the restricted TCR β chains expressed by NK-T cells. Staphylococcal enterotoxin B, in association with antigen-presenting cells expressing I-A and/or I-E, stimulates lymphocytes bearing Vβ 8 TCR and selectively eliminates those T cells in vivo. Vβ 8.3 TCR-bearing T-cell clones can be activated by 1B3.3 mAb. This hamster mAb to a mouse leukocyte antigen does not cross-react with rat leukocytes.

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end.  The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

NOTE:  The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.

940353 Rev. 1
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms. NOTE: The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.
Antibody-Oligo
940353 Rev.1
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940353" on CiteAb

Development References (6)

  1. Behlke MA, Chou HS, Huppi K, Loh DY. Murine T-cell receptor mutants with deletions of beta-chain variable region genes. Proc Natl Acad Sci U S A. 1986; 83(3):767-771. (Biology). View Reference
  2. Haqqi TM, Banerjee S, Anderson GD, David CS. RIII S/J (H-2r). An inbred mouse strain with a massive deletion of T cell receptor V beta genes. J Exp Med. 1989; 169(6):1903-1909. (Biology). View Reference
  3. Hugo P, Kappler JW, Godfrey DI, Marrack PC. Thymic epithelial cell lines that mediate positive selection can also induce thymocyte clonal deletion. J Immunol. 1994; 52(3):1022-1031. (Biology). View Reference
  4. Kersh GJ, Donermeyer DL, Frederick KE, White JM, Hsu BL, Allen PM. TCR transgenic mice in which usage of transgenic alpha- and beta-chains is highly dependent on the level of selecting ligand. J Immunol. 1998; 161(2):585-593. (Immunogen). View Reference
  5. Shinohara K, Ikarashi Y, Maruoka H, et al. Functional and phenotypical characteristics of hepatic NK-like T cells in NK1.1-positive and -negative mouse strains. Eur J Immunol. 1999; 29(6):1871-1878. (Biology). View Reference
  6. White J, Herman A, Pullen AM, Kubo R, Kappler JW, Marrack P. The V beta-specific superantigen staphylococcal enterotoxin B: stimulation of mature T cells and clonal deletion in neonatal mice. Cell. 1989; 56(1):27-35. (Biology). View Reference
View All (6) View Less
940353 Rev. 1

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.